Immunofluorescence (IF) Protocol for Antibody-Oligo Conjugates

Introduction

Immunofluorescence (IF) may be performed on various sample types including tissues and cells. This protocol details the tissue staining procedure using antibody-oligo conjugates, enabling highly multiplexed protein detection with spatial resolution.

Quick Protocol Summary

Deparaffinize and rehydrate baked FFPE slides
Perform two-step antigen retrieval (sodium citrate pH 6, then Tris-HCl pH 8) in a Pascal pressure cooker
Block in a DNA-containing protein buffer to reduce non-specific DNA/oligo interactions
Incubate tissue with Ab-oligo conjugate overnight at 4°C
Wash, fix, then hybridize a complementary fluorescent-labeled imaging strand (IS) to visualize the target
Counterstain nuclei with DAPI, mount, and image

Oligo Considerations

As well as ordering antibody-oligo conjugates for use in Immunofluorescence from AbOliGo, additional oligos are required for the experiment. Sequence and function of each oligo is provided below:

Oligo Name	Sequence	Function	Provided by AbOliGo
IF1	5'_[C6dT]AATATGGAATTCGTCCGAGCCCGTCAAG_3'	Conjugated to antibody 1	Yes
IF2	5'_[C6dT]CCCAAAGGTACCCGTCGTAGTAACAAAG_3'	Conjugated to antibody 2	Yes
IS1	5'_(Dye1)CTTGACGGGCTCGGACGAATTCCATATT(Dye1)_3'	Imaging strand 1 - complementary to IF1	No
IS2	5'_(Dye2)CTTTGTTACTACGACGGGTACCTTTGGG(Dye2)_3'	Imaging strand 2 - complementary to IF2	No

C6dT — a thymidine base carrying the conjugation chemistry on a ~6-carbon linker. Generally used as a spacer between the antibody and oligo.

Reagents and Solutions

Core Reagents

Baked FFPE tissue slides
Xylenes
Ethanol: 100%, 95%, 70%, 50%
Deionized water (diH₂O)
1x PBS, pH 7.4
10 mM sodium citrate, pH 6
1x Tris-HCl, pH 8
2x saline sodium citrate (SSC), pH 7 (0.3M NaCl + 0.03M sodium citrate)
0.1x SSC (for rinse/washes as needed)
2% paraformaldehyde (PFA)
DAPI (final 300nM)
Fluoromount-G

Blocking and Dilution Components

BSA (final 2%)
Sheared salmon sperm DNA (final 0.5 mg/mL)
Dextran sulfate (final 0.5%)

Buffers

Ab-oligo blocking and dilution buffer (in 1x PBS, pH 7.4):

2% BSA
0.5 mg/mL sheared salmon sperm DNA
0.5% dextran sulfate

IS dilution buffer (in 2x SSC):

2% BSA
0.5 mg/mL sheared salmon sperm DNA
0.5% dextran sulfate

Equipment

Pascal Pressure Cooker (Dako) with three slide buckets
Humidified chamber for overnight incubations
Coplin jars or staining dishes
Timer
Coverslips
Fluorescence microscope (AF546/555 channel and DAPI)

Procedure

Step 1: Deparaffinize and Rehydrate (Room Temperature)

Xylenes: 2 × 10 min washes
100% ethanol: 2 × 10 min
95% ethanol: 5 min
70% ethanol: 5 min
50% ethanol: 5 min
Rinse in 100% diH₂O
Wash in 1x PBS, pH 7.4 for 10 min

Step 2: Two-Step Antigen Retrieval (Pascal Pressure Cooker)

Prepare three individual buckets containing: 10 mM sodium citrate (pH 6), 1x Tris-HCl (pH 8), and diH₂O. Place buckets in the pressure cooker chamber with ~500 mL diH₂O covering the bottom of the chamber.

Step A: Sodium citrate retrieval

Immerse slides in sodium citrate buffer (pH 6) and secure the lid
Increase temperature to 125°C ~15 min (pressure reaches ~15 psi)
Remove from heat and allow temperature/pressure to drop to ~90°C and 0 psi over ~25 min
Release any residual pressure, remove lid, and rinse slides in hot diH₂O

Step B: Tris-HCl retrieval

Immediately transfer slides to hot 1x Tris-HCl (pH 8)
Incubate 10 min with the lid on
Transfer slides back to hot diH₂O and cool to room temperature by slowly adding room-temperature water to the vessel
After 5 min in room-temperature diH₂O, wash slides in 1x PBS (pH 7.4) for 5 min at room temperature

Step 3: Block (30 min, Room Temperature)

Block antigen-retrieved slides for 30 min at room temperature in Ab-oligo blocking and dilution buffer (2% BSA, 0.5 mg/mL sheared salmon sperm DNA, 0.5% dextran sulfate in 1x PBS, pH 7.4).

Step 4: Stain with Ab-oligo Conjugate (Overnight, 4°C)

Dilute Ab-oligo conjugate to a final protein concentration of 15 µg/mL in Ab-oligo blocking and dilution buffer (optimal dilution to be determined for each Ab-oligo)
Cover each tissue section with 40 to 100 µL of diluted Ab-oligo
Incubate overnight at 4°C in a humidified chamber

Step 5: Wash and Fix (Next Day)

Wash sections in 2x SSC (pH 7) for 15 min
Fix in 2% PFA for 15 min at room temperature
Wash in 2x SSC: 3 × 5 min

Step 6: Detect with Complementary Imaging Strand (IS) (45 min, Room Temperature)

Protect from light during this step.

Prepare complementary fluorescently-labeled imaging strand (IS) at 350 nM in IS dilution buffer (2% BSA, 0.5 mg/mL sheared salmon sperm DNA, 0.5% dextran sulfate in 2x SSC)
Incubate tissue with IS for 45 min at room temperature, protected from light
Remove IS and wash in 2x SSC: 3 × 5 min. Keep slides protected from light from this point onward

Step 7: Nuclear Counterstain and Final Washes

Apply DAPI at 300 nM for 10 min at room temperature
Wash in 2x SSC: 2 × 5 min

Step 8: Mount

Mount slides in Fluoromount-G and coverslip for imaging.

Notes

Volumes (40-100 µL) depend on section size; ensure complete coverage without drying
Use fresh 2% PFA and handle in a fume hood
Maintain light protection during and after imaging-strand incubation to preserve fluorophore signal

Hints & Tips

Use DNA-relevant blocking buffers (BSA + competitor DNA + dextran sulfate). This is the simplest way to prevent nonspecific binding of DNA.
Titrate Ab-oligo concentration for each target/tissue. Use 15 µg/mL as a starting point, but expect low- and high-abundance proteins to need different dosing.
Titrate imaging strand (IS) concentration and hybridization time. If signal is weak, increase IS concentration before increasing Ab-oligo.
For nuclear haze or sticky nonspecific binding, convert the barcode from ssDNA to dsDNA by pre-hybridizing a short complementary blocker (barcode shielding). dsDNA generally reduces nonspecific interactions versus ssDNA.
Order high-purity fluorescent imaging strands. HPLC purification is commonly recommended for demanding workflows; PAGE may be unsuitable for some dye-labeled oligos.
Handle and store dye-labeled imaging strands like sensitive fluorescent reagents: aliquot, store at -20°C, and minimize UV/light exposure.
Use SSC to adjust stringency of the IS hybridization and washes. Keep pH ~7, and adjust SSC (and wash number/time) to balance specificity versus signal.
Prevent cross-talk in multiplex panels by using orthogonal docking/imager sequences and testing for cross-hybridization during panel build.

Troubleshooting

Symptom	Most Likely Cause	Recommendation
High diffuse background	Insufficient blocking; IS too high; non-specific interactions of the oligo	Increase/extend block; reduce IS (e.g., 350→250→150 nM); add/raise competitor DNA; add washes / increase stringency
Nuclear haze / bright nuclei	Ab-oligo or IS strand interacts non-specifically; stringency too low	Pre-hybridize blocker to form double-stranded antibody-oligo conjugate; increase SSC wash stringency; titrate dextran sulfate downward if needed
Signal very weak	Ab-oligo concentration too low; IS too low; over-stringent washes	Increase Ab-oligo (15→20→30 µg/mL); increase IS (350→500→750 nM); reduce wash stringency/time
No IS signal at all	IS sequence mismatch or degraded; wrong hybridization buffer	Verify DS-IS complementarity; use fresh aliquot of IS; ensure IS is in 2x SSC-based buffer and incubate 45 min
Patchy/uneven staining	Sample dried out; poor reagent distribution; humidity issues	Never let tissue dry; increase volume (toward 100 µL); improve humidity; use a pap pen
Edge of tissue is bright	Evaporation concentrates the reagents	Increase humidity and volume. Level slides and shorten incubation if evaporation persists
Speckles / particulate signal	Ab-oligo aggregation or particulates; potentially dirty buffers	Spin Ab-oligo and IS – use only supernatant. Filter buffers. Aliquot Ab-oligo and avoid freeze-thaws
Autofluorescence	FFPE autofluorescence	Use far-red channel where possible; add a compatible autofluorescence quench step if needed
Signal drops after PFA step	Fixation too long/too strong for this epitope	Reduce PFA incubation time; ensure fresh PFA; compensate with small IS increase if required
Tissue lifting/loss	Harsh handling or retrieval too aggressive	Use charged slides, handle samples gently and use gentle agitation during wash steps
Run-to-run variability	Ab-oligo lot variability; handling/storage differences	Standardize aliquoting and -20°C storage; minimize UV/light; QC each lot; keep retrieval/hybridization timings fixed

Learn more about our Ab-oligo custom service

Reference

Oligonucleotide conjugated antibodies permit highly multiplexed immunofluorescence for future use in clinical histopathology