Antibodies
Anti-14-3-3 gamma Antibody-Oligo Conjugate
SKU: aoc1038
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-14-3-3 gamma Antibody-IF1
Antibody Target
- Target
- 14-3-3 protein gamma
- UniProt Number
- P61981
- Target Description
- Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways (PubMed:15696159, PubMed:16511572, PubMed:36732624). Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif (PubMed:15696159, PubMed:16511572, PubMed:36732624). Binding generally results in the modulation of the activity of the binding partner (PubMed:16511572). Promotes inactivation of WDR24 component of the GATOR2 complex by binding to phosphorylated WDR24 (PubMed:36732624). Participates in the positive regulation of NMDA glutamate receptor activity by promoting the L-glutamate secretion through interaction with BEST1 (PubMed:29121962). Reduces keratinocyte intercellular adhesion, via interacting with PKP1 and sequestering it in the cytoplasm, thereby reducing its incorporation into desmosomes (PubMed:29678907). Plays a role in mitochondrial protein catabolic process (also named MALM) that promotes the degradation of damaged proteins inside mitochondria (PubMed:22532927)..
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1457
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat