Antibodies
Anti-14-3-3 gamma Antibody-Oligo Conjugate
SKU: aoc1038
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-14-3-3 gamma Antibody-IF1
Antibody Target
- Target
- 14-3-3 protein gamma
- UniProt Number
- P61981
- Target Description
- Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. Promotes inactivation of WDR24 component of the GATOR2 complex by binding to phosphorylated WDR24. Participates in the positive regulation of NMDA glutamate receptor activity by promoting the L-glutamate secretion through interaction with BEST1. Reduces keratinocyte intercellular adhesion, via interacting with PKP1 and sequestering it in the cytoplasm, thereby reducing its incorporation into desmosomes. Plays a role in mitochondrial protein catabolic process (also named MALM) that promotes the degradation of damaged proteins inside mitochondria.
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1457
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat