Antibodies
Anti-14-3-3 zeta Antibody-Oligo Conjugate
SKU: aoc1040
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-14-3-3 zeta Antibody-IF1
Antibody Target
- Target
- 14-3-3 protein zeta/delta
- UniProt Number
- P63104
- Target Description
- Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways (PubMed:14578935, PubMed:15071501, PubMed:15644438, PubMed:16376338, PubMed:16959763, PubMed:31024343, PubMed:9360956). Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif (PubMed:35662396). Binding generally results in the modulation of the activity of the binding partner (PubMed:35662396). Promotes cytosolic retention and inactivation of TFEB transcription factor by binding to phosphorylated TFEB (PubMed:35662396). Induces ARHGEF7 activity on RAC1 as well as lamellipodia and membrane ruffle formation (PubMed:16959763). In neurons, regulates spine maturation through the modulation of ARHGEF7 activity (By similarity)..
- Molecular Weight
- 19kDa/28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC62843
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat