Antibodies
Anti-14-3-3 zeta Antibody-Oligo Conjugate
SKU: aoc1040
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-14-3-3 zeta Antibody-IF1
Antibody Target
- Target
- 14-3-3 protein zeta/delta
- UniProt Number
- P63104
- Target Description
- Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. Promotes cytosolic retention and inactivation of TFEB transcription factor by binding to phosphorylated TFEB. Induces ARHGEF7 activity on RAC1 as well as lamellipodia and membrane ruffle formation. In neurons, regulates spine maturation through the modulation of ARHGEF7 activity.
- Molecular Weight
- 19kDa/28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC62843
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat