Antibodies
Anti-4EBP1 Antibody-Oligo Conjugate (ARC56864)
SKU: aoc1045
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-4EBP1 Antibody (ARC56864)-IF1
Antibody Target
- Target
- Eukaryotic translation initiation factor 4E-binding protein 1
- UniProt Number
- Q13541
- Target Description
- Repressor of translation initiation that regulates EIF4E activity by preventing its assembly into the eIF4F complex: hypophosphorylated form competes with EIF4G1/EIF4G3 and strongly binds to EIF4E, leading to repress translation. In contrast, hyperphosphorylated form dissociates from EIF4E, allowing interaction between EIF4G1/EIF4G3 and EIF4E, leading to initiation of translation. Mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways.
- Molecular Weight
- 13kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC56864
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human