Antibodies
Anti-5 Lipoxygenase Antibody-Oligo Conjugate
SKU: aoc1048
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-5 Lipoxygenase Antibody-IF1
Antibody Target
- Target
- Polyunsaturated fatty acid 5-lipoxygenase
- UniProt Number
- P09917
- Target Description
- Catalyzes the oxygenation of arachidonate ((5Z,8Z,11Z,14Z)-eicosatetraenoate) to 5-hydroperoxyeicosatetraenoate (5-HPETE) followed by the dehydration to 5,6- epoxyeicosatetraenoate (Leukotriene A4/LTA4), the first two steps in the biosynthesis of leukotrienes, which are potent mediators of inflammation. Also catalyzes the oxygenation of arachidonate into 8-hydroperoxyicosatetraenoate (8-HPETE) and 12-hydroperoxyicosatetraenoate (12-HPETE). Displays lipoxin synthase activity being able to convert (15S)-HETE into a conjugate tetraene. Although arachidonate is the preferred substrate, this enzyme can also metabolize oxidized fatty acids derived from arachidonate such as (15S)-HETE, eicosapentaenoate (EPA) such as (18R)- and (18S)-HEPE or docosahexaenoate (DHA) which lead to the formation of specialized pro-resolving mediators (SPM) lipoxin and resolvins E and D respectively, therefore it participates in anti-inflammatory responses. Oxidation of DHA directly inhibits endothelial cell proliferation and sprouting angiogenesis via peroxisome proliferator-activated receptor gamma (PPARgamma). It does not catalyze the oxygenation of linoleic acid and does not convert (5S)-HETE to lipoxin isomers. In addition to inflammatory processes, it participates in dendritic cell migration, wound healing through an antioxidant mechanism based on heme oxygenase-1 (HO-1) regulation expression, monocyte adhesion to the endothelium via ITGAM expression on monocytes. Moreover, it helps establish an adaptive humoral immunity by regulating primary resting B cells and follicular helper T cells and participates in the CD40-induced production of reactive oxygen species (ROS) after CD40 ligation in B cells through interaction with PIK3R1 that bridges ALOX5 with CD40. May also play a role in glucose homeostasis, regulation of insulin secretion and palmitic acid-induced insulin resistance via AMPK. Can regulate bone mineralization and fat cell differentiation increases in induced pluripotent stem cells.
- Molecular Weight
- 78kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1926
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat