Antibodies
Anti-53BP1 Antibody-Oligo Conjugate
SKU: aoc1049
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-53BP1 Antibody-IF1
Antibody Target
- Target
- TP53-binding protein 1
- UniProt Number
- Q12888
- Target Description
- Double-strand break (DSB) repair protein involved in response to DNA damage, telomere dynamics and class-switch recombination (CSR) during antibody genesis (PubMed:12364621, PubMed:17190600, PubMed:21144835, PubMed:22553214, PubMed:23333306, PubMed:27153538, PubMed:28241136, PubMed:31135337, PubMed:37696958). Plays a key role in the repair of double-strand DNA breaks (DSBs) in response to DNA damage by promoting non-homologous end joining (NHEJ)-mediated repair of DSBs and specifically counteracting the function of the homologous recombination (HR) repair protein BRCA1 (PubMed:22553214, PubMed:23333306, PubMed:23727112, PubMed:27153538, PubMed:31135337). In response to DSBs, phosphorylation by ATM promotes interaction with RIF1 and dissociation from NUDT16L1/TIRR, leading to recruitment to DSBs sites (PubMed:28241136). Recruited to DSBs sites by recognizing and binding histone H2A monoubiquitinated at 'Lys-15' (H2AK15Ub) and histone H4 dimethylated at 'Lys-20' (H4K20me2), two histone marks that are present at DSBs sites (PubMed:17190600, PubMed:23760478, PubMed:27153538, PubMed:28241136). Required for immunoglobulin class-switch recombination (CSR) during antibody genesis, a process that involves the generation of DNA DSBs (PubMed:23345425). Participates in the repair and the orientation of the broken DNA ends during CSR (By similarity). In contrast, it is not required for classic NHEJ and V(D)J recombination (By similarity). Promotes NHEJ of dysfunctional telomeres via interaction with PAXIP1 (PubMed:23727112)..
- Molecular Weight
- 214kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC0850
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse