Antibodies
Anti-67kDa Laminin Receptor Antibody-Oligo Conjugate
SKU: aoc1052
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-67kDa Laminin Receptor Antibody-IF1
Antibody Target
- Target
- Small ribosomal subunit protein uS2
- UniProt Number
- P08865
- Target Description
- Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in the consequent activation of signaling transduction pathways. May play a role in cell fate determination and tissue morphogenesis. Acts as a PPP1R16B-dependent substrate of PPP1CA.; FUNCTION: (Microbial infection) Acts as a receptor for the Adeno-associated viruses 2,3,8 and 9.; FUNCTION: (Microbial infection) Acts as a receptor for the Dengue virus.; FUNCTION: (Microbial infection) Acts as a receptor for the Sindbis virus.; FUNCTION: (Microbial infection) Acts as a receptor for the Venezuelan equine encephalitis virus.; FUNCTION: (Microbial infection) Acts as a receptor for the pathogenic prion protein.; FUNCTION: (Microbial infection) Acts as a receptor for bacteria.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2109
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat