Antibodies
Anti-A RAF Antibody-Oligo Conjugate
SKU: aoc1053
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-A RAF Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase A-Raf
- UniProt Number
- P10398
- Target Description
- Involved in the transduction of mitogenic signals from the cell membrane to the nucleus. May also regulate the TOR signaling cascade. Phosphorylates PFKFB2 (PubMed:36402789)..; FUNCTION: [Isoform 2]: Serves as a positive regulator of myogenic differentiation by inducing cell cycle arrest, the expression of myogenin and other muscle-specific proteins, and myotube formation..
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1782
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human