Antibodies
Anti-ABCE1 Antibody-Oligo Conjugate
SKU: aoc1057
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ABCE1 Antibody-IF1
Antibody Target
- Target
- ATP-binding cassette sub-family E member 1
- UniProt Number
- P61221
- Target Description
- Nucleoside-triphosphatase (NTPase) involved in ribosome recycling by mediating ribosome disassembly. Able to hydrolyze ATP, GTP, UTP and CTP. Splits ribosomes into free 60S subunits and tRNA- and mRNA-bound 40S subunits. Acts either after canonical termination facilitated by release factors (ETF1/eRF1) or after recognition of stalled and vacant ribosomes by mRNA surveillance factors (PELO/Pelota). Involved in the No-Go Decay (NGD) pathway: recruited to stalled ribosomes by the Pelota-HBS1L complex, and drives the disassembly of stalled ribosomes, followed by degradation of damaged mRNAs as part of the NGD pathway. Also plays a role in quality control of translation of mitochondrial outer membrane-localized mRNA. As part of the PINK1-regulated signaling, ubiquitinated by CNOT4 upon mitochondria damage; this modification generates polyubiquitin signals that recruit autophagy receptors to the mitochondrial outer membrane and initiate mitophagy. RNASEL-specific protein inhibitor which antagonizes the binding of 2-5A (5'-phosphorylated 2',5'-linked oligoadenylates) to RNASEL. Negative regulator of the anti-viral effect of the interferon-regulated 2-5A/RNASEL pathway.; FUNCTION: (Microbial infection) May act as a chaperone for post-translational events during HIV-1 capsid assembly.; FUNCTION: (Microbial infection) Plays a role in the down-regulation of the 2-5A/RNASEL pathway during encephalomyocarditis virus (EMCV) and HIV-1 infections.
- Molecular Weight
- 67kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1445
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse