Antibodies
Anti-ACAA2 Antibody-Oligo Conjugate (ARC2533)
SKU: aoc1064
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACAA2 Antibody (ARC2533)-IF1
Antibody Target
- Target
- 3-ketoacyl-CoA thiolase, mitochondrial
- UniProt Number
- P42765
- Target Description
- In the production of energy from fats, this is one of the enzymes that catalyzes the last step of the mitochondrial beta-oxidation pathway, an aerobic process breaking down fatty acids into acetyl-CoA (Probable). Using free coenzyme A/CoA, catalyzes the thiolytic cleavage of medium- to long-chain unbranched 3-oxoacyl-CoAs into acetyl-CoA and a fatty acyl-CoA shortened by two carbon atoms (Probable). Also catalyzes the condensation of two acetyl-CoA molecules into acetoacetyl-CoA and could be involved in the production of ketone bodies (Probable). Also displays hydrolase activity on various fatty acyl-CoAs (PubMed:25478839). Thereby, could be responsible for the production of acetate in a side reaction to beta-oxidation (Probable). Abolishes BNIP3-mediated apoptosis and mitochondrial damage (PubMed:18371312)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2533
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat