Antibodies
Anti-ACADS Antibody-Oligo Conjugate
SKU: aoc1067
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACADS Antibody-IF1
Antibody Target
- Target
- Short-chain specific acyl-CoA dehydrogenase, mitochondrial
- UniProt Number
- P16219
- Target Description
- Short-chain specific acyl-CoA dehydrogenase is one of the acyl-CoA dehydrogenases that catalyze the first step of mitochondrial fatty acid beta-oxidation, an aerobic process breaking down fatty acids into acetyl-CoA and allowing the production of energy from fats. The first step of fatty acid beta-oxidation consists in the removal of one hydrogen from C-2 and C-3 of the straight-chain fatty acyl-CoA thioester, resulting in the formation of trans-2-enoyl-CoA. Among the different mitochondrial acyl-CoA dehydrogenases, short-chain specific acyl-CoA dehydrogenase acts specifically on acyl-CoAs with saturated 4 to 6 carbons long primary chains.
- Molecular Weight
- 44kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2901
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat