Antibodies
Anti-ACAT1 Antibody-Oligo Conjugate
SKU: aoc1068
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACAT1 Antibody-IF1
Antibody Target
- Target
- Acetyl-CoA acetyltransferase, mitochondrial
- UniProt Number
- P24752
- Target Description
- This is one of the enzymes that catalyzes the last step of the mitochondrial beta-oxidation pathway, an aerobic process breaking down fatty acids into acetyl-CoA. Using free coenzyme A/CoA, catalyzes the thiolytic cleavage of medium- to long-chain 3-oxoacyl-CoAs into acetyl-CoA and a fatty acyl-CoA shortened by two carbon atoms. The activity of the enzyme is reversible and it can also catalyze the condensation of two acetyl-CoA molecules into acetoacetyl-CoA. Thereby, it plays a major role in ketone body metabolism.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC64030
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat