Antibodies
Anti-ACE2 Antibody-Oligo Conjugate
SKU: aoc1072
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACE2 Antibody-IF1
Antibody Target
- Target
- Angiotensin-converting enzyme 2
- UniProt Number
- Q9BYF1
- Target Description
- Essential counter-regulatory carboxypeptidase of the renin-angiotensin hormone system that is a critical regulator of blood volume, systemic vascular resistance, and thus cardiovascular homeostasis (PubMed:27217402). Converts angiotensin I to angiotensin 1-9, a nine-amino acid peptide with anti-hypertrophic effects in cardiomyocytes, and angiotensin II to angiotensin 1-7, which then acts as a beneficial vasodilator and anti-proliferation agent, counterbalancing the actions of the vasoconstrictor angiotensin II (PubMed:10924499, PubMed:10969042, PubMed:11815627, PubMed:14504186, PubMed:19021774). Also removes the C-terminal residue from three other vasoactive peptides, neurotensin, kinetensin, and des-Arg bradykinin, but is not active on bradykinin (PubMed:10969042, PubMed:11815627). Also cleaves other biological peptides, such as apelins (apelin-13, [Pyr1]apelin-13, apelin-17, apelin-36), casomorphins (beta-casomorphin-7, neocasomorphin) and dynorphin A with high efficiency (PubMed:11815627, PubMed:27217402, PubMed:28293165). In addition, ACE2 C-terminus is homologous to collectrin and is responsible for the trafficking of the neutral amino acid transporter SL6A19 to the plasma membrane of gut epithelial cells via direct interaction, regulating its expression on the cell surface and its catalytic activity (PubMed:18424768, PubMed:19185582)..; FUNCTION: (Microbial infection) Acts as a receptor for human coronaviruses SARS-CoV and SARS-CoV-2, as well as human coronavirus NL63/HCoV-NL63..; FUNCTION: [Isoform 2]: Non-functional as a carboxypeptidase..; FUNCTION: [Isoform 2]: (Microbial infection) Non-functional as a receptor for human coronavirus SARS-CoV-2..
- Molecular Weight
- 53 kDa/92 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat