Antibodies
Anti-Aconitase 1 Antibody-Oligo Conjugate
SKU: aoc1077
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aconitase 1 Antibody-IF1
Antibody Target
- Target
- Cytoplasmic aconitate hydratase
- UniProt Number
- P21399
- Target Description
- Bifunctional iron sensor that switches between 2 activities depending on iron availability (PubMed:1281544, PubMed:1946430, PubMed:8041788). Iron deprivation, promotes its mRNA binding activity through which it regulates the expression of genes involved in iron uptake, sequestration and utilization (PubMed:1281544, PubMed:1946430, PubMed:23891004, PubMed:8041788). Binds to iron-responsive elements (IRES) in the untranslated region of target mRNAs preventing for instance the translation of ferritin and aminolevulinic acid synthase and stabilizing the transferrin receptor mRNA (PubMed:1281544, PubMed:1946430, PubMed:23891004, PubMed:8041788)..; FUNCTION: Conversely, when cellular iron levels are high, binds a 4Fe-4S cluster which precludes RNA binding activity and promotes the aconitase activity, the isomerization of citrate to isocitrate via cis-aconitate..
- Molecular Weight
- 98kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2731
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat