Antibodies
Anti-ACSL1 Antibody-Oligo Conjugate
SKU: aoc1081
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACSL1 Antibody-IF1
Antibody Target
- Target
- Long-chain-fatty-acid--CoA ligase 1
- UniProt Number
- P33121
- Target Description
- Catalyzes the conversion of long-chain fatty acids to their active form acyl-CoAs for both synthesis of cellular lipids, and degradation via beta-oxidation. Preferentially uses palmitoleate, oleate and linoleate. Preferentially activates arachidonate than epoxyeicosatrienoic acids (EETs) or hydroxyeicosatrienoic acids (HETEs).
- Molecular Weight
- 78kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC69127
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat