Antibodies
Anti-ACSL3 Antibody-Oligo Conjugate
SKU: aoc1082
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACSL3 Antibody-IF1
Antibody Target
- Target
- Fatty acid CoA ligase Acsl3
- UniProt Number
- O95573
- Target Description
- Acyl-CoA synthetases (ACSL) activates long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation (PubMed:22633490). Required for the incorporation of fatty acids into phosphatidylcholine, the major phospholipid located on the surface of VLDL (very low density lipoproteins) (PubMed:18003621). Has mainly an anabolic role in energy metabolism. Mediates hepatic lipogenesis. Preferentially uses myristate, laurate, arachidonate and eicosapentaenoate as substrates. Both isoforms exhibit the same level of activity (By similarity)..
- Molecular Weight
- 80kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55219
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat