Antibodies
Anti-ACSL3 Antibody-Oligo Conjugate
SKU: aoc1082
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ACSL3 Antibody-IF1
Antibody Target
- Target
- Fatty acid CoA ligase Acsl3
- UniProt Number
- O95573
- Target Description
- Acyl-CoA synthetases (ACSL) activates long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation. Required for the incorporation of fatty acids into phosphatidylcholine, the major phospholipid located on the surface of VLDL (very low density lipoproteins). Has mainly an anabolic role in energy metabolism. Mediates hepatic lipogenesis. Preferentially uses myristate, laurate, arachidonate and eicosapentaenoate as substrates. Both isoforms exhibit the same level of activity.
- Molecular Weight
- 80kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55219
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat