Antibodies
Anti-α-Actinin-4 Antibody-Oligo Conjugate
SKU: aoc3846
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-α-Actinin-4 Antibody-IF1
Antibody Target
- Target
- Alpha-actinin-4
- UniProt Number
- O43707
- Target Description
- F-actin cross-linking protein which is thought to anchor actin to a variety of intracellular structures. This is a bundling protein (Probable). Probably involved in vesicular trafficking via its association with the CART complex. The CART complex is necessary for efficient transferrin receptor recycling but not for EGFR degradation. Involved in tight junction assembly in epithelial cells probably through interaction with MICALL2. Links MICALL2 to the actin cytoskeleton and recruits it to the tight junctions. May also function as a transcriptional coactivator, stimulating transcription mediated by the nuclear hormone receptors PPARG and RARA. Association with IGSF8 regulates the immune synapse formation and is required for efficient T-cell activation.
- Molecular Weight
- 105kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC1959
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat