Antibodies
Anti-AIF Antibody-Oligo Conjugate
SKU: aoc1117
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AIF Antibody-IF1
Antibody Target
- Target
- Apoptosis-inducing factor 1, mitochondrial
- UniProt Number
- O95831
- Target Description
- Functions both as NADH oxidoreductase and as regulator of apoptosis (PubMed:17094969, PubMed:20362274, PubMed:23217327, PubMed:33168626). In response to apoptotic stimuli, it is released from the mitochondrion intermembrane space into the cytosol and to the nucleus, where it functions as a proapoptotic factor in a caspase-independent pathway (PubMed:20362274). Release into the cytoplasm is mediated upon binding to poly-ADP-ribose chains (By similarity). The soluble form (AIFsol) found in the nucleus induces 'parthanatos' i.e. caspase-independent fragmentation of chromosomal DNA (PubMed:20362274). Binds to DNA in a sequence-independent manner (PubMed:27178839). Interacts with EIF3G, and thereby inhibits the EIF3 machinery and protein synthesis, and activates caspase-7 to amplify apoptosis (PubMed:17094969). Plays a critical role in caspase-independent, pyknotic cell death in hydrogen peroxide-exposed cells (PubMed:19418225). In contrast, participates in normal mitochondrial metabolism. Plays an important role in the regulation of respiratory chain biogenesis by interacting with CHCHD4 and controlling CHCHD4 mitochondrial import (PubMed:26004228)..; FUNCTION: [Isoform 4]: Has NADH oxidoreductase activity. Does not induce nuclear apoptosis..; FUNCTION: [Isoform 5]: Pro-apoptotic isoform..
- Molecular Weight
- 67kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0015
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat