Antibodies
Anti-AIF Antibody-Oligo Conjugate
SKU: aoc1117
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AIF Antibody-IF1
Antibody Target
- Target
- Apoptosis-inducing factor 1, mitochondrial
- UniProt Number
- O95831
- Target Description
- Functions both as NADH oxidoreductase and as regulator of apoptosis. In response to apoptotic stimuli, it is released from the mitochondrion intermembrane space into the cytosol and to the nucleus, where it functions as a proapoptotic factor in a caspase-independent pathway. Release into the cytoplasm is mediated upon binding to poly-ADP-ribose chains. The soluble form (AIFsol) found in the nucleus induces 'parthanatos' i.e. caspase-independent fragmentation of chromosomal DNA. Binds to DNA in a sequence-independent manner. Interacts with EIF3G, and thereby inhibits the EIF3 machinery and protein synthesis, and activates caspase-7 to amplify apoptosis. Plays a critical role in caspase-independent, pyknotic cell death in hydrogen peroxide-exposed cells. In contrast, participates in normal mitochondrial metabolism. Plays an important role in the regulation of respiratory chain biogenesis by interacting with CHCHD4 and controlling CHCHD4 mitochondrial import.; FUNCTION: [Isoform 4]: Has NADH oxidoreductase activity. Does not induce nuclear apoptosis.; FUNCTION: [Isoform 5]: Pro-apoptotic isoform.
- Molecular Weight
- 67kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0015
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat