Antibodies
Anti-Ajuba Antibody-Oligo Conjugate
SKU: aoc1118
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Ajuba Antibody-PLA1
Antibody Target
- Target
- LIM domain-containing protein ajuba
- UniProt Number
- Q96IF1
- Target Description
- Adapter or scaffold protein which participates in the assembly of numerous protein complexes and is involved in several cellular processes such as cell fate determination, cytoskeletal organization, repression of gene transcription, mitosis, cell-cell adhesion, cell differentiation, proliferation and migration. Contributes to the linking and/or strengthening of epithelia cell-cell junctions in part by linking adhesive receptors to the actin cytoskeleton. May be involved in signal transduction from cell adhesion sites to the nucleus. Plays an important role in regulation of the kinase activity of AURKA for mitotic commitment. Also a component of the IL-1 signaling pathway modulating IL-1-induced NFKB1 activation by influencing the assembly and activity of the PRKCZ-SQSTM1-TRAF6 multiprotein signaling complex. Functions as an HDAC-dependent corepressor for a subset of GFI1 target genes. Acts as a transcriptional corepressor for SNAI1 and SNAI2/SLUG-dependent repression of E-cadherin transcription. Acts as a hypoxic regulator by bridging an association between the prolyl hydroxylases and VHL enabling efficient degradation of HIF1A. Positively regulates microRNA (miRNA)-mediated gene silencing. Negatively regulates the Hippo signaling pathway and antagonizes phosphorylation of YAP1.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC54979
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat