Back to Protein Interactions

Proximity Ligation Assay (PLA) Protocol

Key takeaways

  • This proximity ligation assay (PLA) protocol covers the immunofluorescence format: fix and permeabilize cells, bind antibody-oligo conjugates (AOCs), ligate connector oligos into a DNA circle, amplify by rolling circle amplification, then detect with a fluorescent probe.
  • AbOliGo supplies the two AOC-conjugated PLA oligos; you supply the connector oligos and the fluorescent detector oligo. Connector oligos must carry a 5' phosphate or T4 DNA ligase cannot seal the nick and no circles form.
  • Run a minimum control set (no primary, single primary, no ligase, no polymerase, no connector, random detection probe) so you can tell which stage of the assay is failing.
  • The biggest cause of false positives is free oligo and antibody aggregates; spin down AOCs and oligos before use and avoid freeze-thaw.

Introduction

PLA may be used in two formats:

  • Fixed cells/tissues mounted on slides (immunofluorescence - IF)
  • Fixed cells in solution (flow cytometry or co-immunoprecipitation)

The following protocol covers the IF format which is provided for guidance purposes. A series of optimization steps will be critical to ensure a positive outcome.


Oligo Considerations

As well as ordering antibody-oligo conjugates for use in PLA from AbOliGo, additional oligos are required for the experiment. Sequence and function of each oligo is provided below:

Oligo NameSequenceFunctionProvided by AbOliGo
PLA 1[C6dT]ACAACAACAAGAATGGAACCTCGCTAGAACGTConjugated to antibody 1Yes
PLA 2[C6dT]CAACAACAAAATAGTTTCGGTCGAAGTTAGTCCConjugated to antibody 2Yes
Connector 1[Phos]AGGTTCCATTCAAAGGACTAACTTCComplimentary to oligos on both antibodiesNo
Connector 2[Phos]GACCGAACTATCTAGTGCTGGATGATCG TCCCCCCCTGCACCTCAAAACACCCAACGTTCTAGCGComplimentary to oligos on both antibodiesNo
Detector[fluorescent dye]CTAGTGCTGGATGATCGTCC[fluorescent dye]Anneals to the amplified DNANo

C6dT - a thymidine base carrying the conjugation chemistry on a ~6-carbon linker. Generally used as a spacer between the antibody and oligo.

Phos – 5' phosphate group is critical for ligation chemistry. T4 DNA ligase can only seal a nick when it has a 3'-OH on one strand end and a 5'-phosphate on the other.


Protocol

A. Cell Fixation + Permeabilization

  1. Fix cells with 4% PFA in PBS, 15 min RT.
  2. Wash 3× with PBS.
  3. Permeabilize with 0.5% Triton X-100 in 1% BSA/PBS, 30 min at 37 °C.
  4. Wash 3× with PBS.

B. PLA Binding (Antibody-Oligo Conjugates, AOCs)

  1. Keep cells covered with a 2–5 µL liquid film so they never dry.
  2. Add antibody-oligo conjugates at 2–25 ng/µL, 1 h at RT (optimal dilution will have to be pre-determined for each antibody-oligo conjugate).
  3. Wash 4× with TBS-T over a total of 1 h.

C. Connector Hybridization + Ligation (Circle Formation)

Incubate 45 min at 30 °C in 1× T4 ligase buffer containing:

  • T4 DNA ligase: 1 U/µL
  • Connector strands: 125 nM (Connector 1 + Connector 2)
  • BSA: 125 ng/mL
  • ddH₂O to volume

Wash 3× with TBS-T.

D. Rolling Circle Amplification (RCA)

Incubate 100 min at 32 °C (orbital shaking) in 1× phi29 buffer containing:

  • phi29 polymerase: 0.25 U/µL
  • dNTPs: 200 µM
  • BSA: 200 µg/mL

Wash 2× with TBS-T.

E. Fluorescent Detection

Counterstain 30 min in SSC containing:

  • DAPI: 1 µg/mL
  • Detection probe: 6 nM
  • Phalloidin-Atto488: 20 nM

Wash 3× with TBS, then image by fluorescent microscope.


Hints and Tips

1. Use Controls That Actually Diagnose Which Stage of the PLA is Failing

PLA has multiple "gates" (antibody binding → connector hybridization → ligation → RCA → detection probe hybridization). Use relevant controls to confirm each stage has worked:

Minimum control set:

  • No primary antibody (background from connectors/detection probe sticking)
  • Single primary only (or single-probe control) to see if one antibody/oligo is the main background driver
  • No ligase and no polymerase controls (distinguish "ligation-limited" vs "RCA-limited")
  • No connector control (identify non-specific RCA priming/detection probe binding)
  • Random non-specific detection probe (detects probe stickiness)

2. Don't Over-Interpret "Puncta" as "Direct Binding"

PLA is fundamentally a proximity readout. Although the technique is powerful, a positive dot can also occur if proteins are packed tightly in a busy area of the cell, or if the antibodies sit in a way that brings the DNA probes close, even when the proteins aren't truly interacting.

What to do:

  • Confirm with orthogonal evidence (co-IP, FRET/BRET, genetic epistasis) when the claim is "direct interaction"
  • Use biological controls (KO/knockdown, mutation that breaks binding, ligand dependence)

Biggest cause of false positives in PLA: Free oligo + aggregates. Antibody aggregates create "proximity" artificially (many oligos in a tight cluster).

Mitigations:

  • Spin down AOCs and oligos before use, remove supernatant which should be used in the assay. Avoid any pellet aggregates.
  • Avoid freeze–thaw of antibodies and oligos.

3. Oligo 5' and 3' Considerations

Ligation at a nick requires the right end chemistry (classically 5' phosphate / 3' hydroxyl at the ligation junction). If you change suppliers or reorder oligos, confirm whether the connector oligos are ordered phosphorylated at the 5' end. This is a common "everything binds but no circles form" failure mode.

4. Sample Handling

  • Fixation/permeabilization/antigen retrieval must be compatible for both AOCs; optimize each individually using primary and the relevant secondary antibodies. Then combine for the PLA assay.
  • Too-high AOC concentrations are a classic reason for high background; titrate each AOC individually while holding the other constant if you are having background issues.
  • Never allow the samples to dry out, best to use a humidifying chamber.
  • Remove residual wash buffer before ligation/amplification with Kimwipes; leftover wash dilutes enzymes and reduces efficiency.
  • Prevent cross-contamination between samples, wash different antibody conditions separately when possible; avoid bulk washing when multiple antibody pairs/controls are on the same run.
  • Keep enzymes cold while setting up; don't let diluted enzyme mixes sit around.

Troubleshooting

ProblemLikely CauseSuggestion to Overcome
Positive control shows poor signalReaction volume insufficientEnsure relevant buffer covers the whole sample + use a humidifying chamber to prevent evaporation
Poor ligation efficiencyEnsure to remove all residual traces of the wash buffer using Kimwipes. Prepare fresh ligation buffer.
Poor amplificationEnsure to remove all residual traces of the wash buffer using Kimwipes. Prepare fresh amplification buffer.
High backgroundWashing ineffectiveIncrease number of wash steps + volume of wash buffer
Sample dried outUse a humidity chamber to prevent evaporation + sufficient buffer to cover the sample
Cell autofluorescenceUse a quencher to reduce autofluorescence
Antibody aggregates cause non-specific punctate stainingSpin down antibody-oligo conjugates to remove aggregates. Use freshly prepared buffers (incubation/wash buffers).

References

Need antibody-oligo conjugates for your PLA experiment? Contact us to discuss your requirements.