Key takeaways
- This proximity ligation assay (PLA) protocol covers the immunofluorescence format: fix and permeabilize cells, bind antibody-oligo conjugates (AOCs), ligate connector oligos into a DNA circle, amplify by rolling circle amplification, then detect with a fluorescent probe.
- AbOliGo supplies the two AOC-conjugated PLA oligos; you supply the connector oligos and the fluorescent detector oligo. Connector oligos must carry a 5' phosphate or T4 DNA ligase cannot seal the nick and no circles form.
- Run a minimum control set (no primary, single primary, no ligase, no polymerase, no connector, random detection probe) so you can tell which stage of the assay is failing.
- The biggest cause of false positives is free oligo and antibody aggregates; spin down AOCs and oligos before use and avoid freeze-thaw.
Introduction
PLA may be used in two formats:
- Fixed cells/tissues mounted on slides (immunofluorescence - IF)
- Fixed cells in solution (flow cytometry or co-immunoprecipitation)
The following protocol covers the IF format which is provided for guidance purposes. A series of optimization steps will be critical to ensure a positive outcome.
Oligo Considerations
As well as ordering antibody-oligo conjugates for use in PLA from AbOliGo, additional oligos are required for the experiment. Sequence and function of each oligo is provided below:
| Oligo Name | Sequence | Function | Provided by AbOliGo |
|---|---|---|---|
| PLA 1 | [C6dT]ACAACAACAAGAATGGAACCTCGCTAGAACGT | Conjugated to antibody 1 | Yes |
| PLA 2 | [C6dT]CAACAACAAAATAGTTTCGGTCGAAGTTAGTCC | Conjugated to antibody 2 | Yes |
| Connector 1 | [Phos]AGGTTCCATTCAAAGGACTAACTTC | Complimentary to oligos on both antibodies | No |
| Connector 2 | [Phos]GACCGAACTATCTAGTGCTGGATGATCG TCCCCCCCTGCACCTCAAAACACCCAACGTTCTAGCG | Complimentary to oligos on both antibodies | No |
| Detector | [fluorescent dye]CTAGTGCTGGATGATCGTCC[fluorescent dye] | Anneals to the amplified DNA | No |
C6dT - a thymidine base carrying the conjugation chemistry on a ~6-carbon linker. Generally used as a spacer between the antibody and oligo.
Phos – 5' phosphate group is critical for ligation chemistry. T4 DNA ligase can only seal a nick when it has a 3'-OH on one strand end and a 5'-phosphate on the other.
Protocol
A. Cell Fixation + Permeabilization
- Fix cells with 4% PFA in PBS, 15 min RT.
- Wash 3× with PBS.
- Permeabilize with 0.5% Triton X-100 in 1% BSA/PBS, 30 min at 37 °C.
- Wash 3× with PBS.
B. PLA Binding (Antibody-Oligo Conjugates, AOCs)
- Keep cells covered with a 2–5 µL liquid film so they never dry.
- Add antibody-oligo conjugates at 2–25 ng/µL, 1 h at RT (optimal dilution will have to be pre-determined for each antibody-oligo conjugate).
- Wash 4× with TBS-T over a total of 1 h.
C. Connector Hybridization + Ligation (Circle Formation)
Incubate 45 min at 30 °C in 1× T4 ligase buffer containing:
- T4 DNA ligase: 1 U/µL
- Connector strands: 125 nM (Connector 1 + Connector 2)
- BSA: 125 ng/mL
- ddH₂O to volume
Wash 3× with TBS-T.
D. Rolling Circle Amplification (RCA)
Incubate 100 min at 32 °C (orbital shaking) in 1× phi29 buffer containing:
- phi29 polymerase: 0.25 U/µL
- dNTPs: 200 µM
- BSA: 200 µg/mL
Wash 2× with TBS-T.
E. Fluorescent Detection
Counterstain 30 min in SSC containing:
- DAPI: 1 µg/mL
- Detection probe: 6 nM
- Phalloidin-Atto488: 20 nM
Wash 3× with TBS, then image by fluorescent microscope.
Hints and Tips
1. Use Controls That Actually Diagnose Which Stage of the PLA is Failing
PLA has multiple "gates" (antibody binding → connector hybridization → ligation → RCA → detection probe hybridization). Use relevant controls to confirm each stage has worked:
Minimum control set:
- No primary antibody (background from connectors/detection probe sticking)
- Single primary only (or single-probe control) to see if one antibody/oligo is the main background driver
- No ligase and no polymerase controls (distinguish "ligation-limited" vs "RCA-limited")
- No connector control (identify non-specific RCA priming/detection probe binding)
- Random non-specific detection probe (detects probe stickiness)
2. Don't Over-Interpret "Puncta" as "Direct Binding"
PLA is fundamentally a proximity readout. Although the technique is powerful, a positive dot can also occur if proteins are packed tightly in a busy area of the cell, or if the antibodies sit in a way that brings the DNA probes close, even when the proteins aren't truly interacting.
What to do:
- Confirm with orthogonal evidence (co-IP, FRET/BRET, genetic epistasis) when the claim is "direct interaction"
- Use biological controls (KO/knockdown, mutation that breaks binding, ligand dependence)
Biggest cause of false positives in PLA: Free oligo + aggregates. Antibody aggregates create "proximity" artificially (many oligos in a tight cluster).
Mitigations:
- Spin down AOCs and oligos before use, remove supernatant which should be used in the assay. Avoid any pellet aggregates.
- Avoid freeze–thaw of antibodies and oligos.
3. Oligo 5' and 3' Considerations
Ligation at a nick requires the right end chemistry (classically 5' phosphate / 3' hydroxyl at the ligation junction). If you change suppliers or reorder oligos, confirm whether the connector oligos are ordered phosphorylated at the 5' end. This is a common "everything binds but no circles form" failure mode.
4. Sample Handling
- Fixation/permeabilization/antigen retrieval must be compatible for both AOCs; optimize each individually using primary and the relevant secondary antibodies. Then combine for the PLA assay.
- Too-high AOC concentrations are a classic reason for high background; titrate each AOC individually while holding the other constant if you are having background issues.
- Never allow the samples to dry out, best to use a humidifying chamber.
- Remove residual wash buffer before ligation/amplification with Kimwipes; leftover wash dilutes enzymes and reduces efficiency.
- Prevent cross-contamination between samples, wash different antibody conditions separately when possible; avoid bulk washing when multiple antibody pairs/controls are on the same run.
- Keep enzymes cold while setting up; don't let diluted enzyme mixes sit around.
Troubleshooting
| Problem | Likely Cause | Suggestion to Overcome |
|---|---|---|
| Positive control shows poor signal | Reaction volume insufficient | Ensure relevant buffer covers the whole sample + use a humidifying chamber to prevent evaporation |
| Poor ligation efficiency | Ensure to remove all residual traces of the wash buffer using Kimwipes. Prepare fresh ligation buffer. | |
| Poor amplification | Ensure to remove all residual traces of the wash buffer using Kimwipes. Prepare fresh amplification buffer. | |
| High background | Washing ineffective | Increase number of wash steps + volume of wash buffer |
| Sample dried out | Use a humidity chamber to prevent evaporation + sufficient buffer to cover the sample | |
| Cell autofluorescence | Use a quencher to reduce autofluorescence | |
| Antibody aggregates cause non-specific punctate staining | Spin down antibody-oligo conjugates to remove aggregates. Use freshly prepared buffers (incubation/wash buffers). |
References
- Preparation of single- and double-oligonucleotide antibody conjugates and their application for protein analytics
- The method developer's guide to oligonucleotide design
Need antibody-oligo conjugates for your PLA experiment? Contact us to discuss your requirements.