Antibodies
Anti-AKR1B1 Antibody-Oligo Conjugate
SKU: aoc1122
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AKR1B1 Antibody-IF1
Antibody Target
- Target
- Aldo-keto reductase family 1 member B1
- UniProt Number
- P15121
- Target Description
- Catalyzes the NADPH-dependent reduction of a wide variety of carbonyl-containing compounds to their corresponding alcohols. Displays enzymatic activity towards endogenous metabolites such as aromatic and aliphatic aldehydes, ketones, monosacharides, bile acids and xenobiotics substrates. Key enzyme in the polyol pathway, catalyzes reduction of glucose to sorbitol during hyperglycemia (PubMed:1936586). Reduces steroids and their derivatives and prostaglandins. Displays low enzymatic activity toward all-trans-retinal, 9-cis-retinal, and 13-cis-retinal (PubMed:12732097, PubMed:19010934, PubMed:8343525). Catalyzes the reduction of diverse phospholipid aldehydes such as 1-palmitoyl-2-(5-oxovaleroyl)-sn -glycero-3-phosphoethanolamin (POVPC) and related phospholipid aldehydes that are generated from the oxydation of phosphotidylcholine and phosphatdyleethanolamides (PubMed:17381426). Plays a role in detoxifying dietary and lipid-derived unsaturated carbonyls, such as crotonaldehyde, 4-hydroxynonenal, trans-2-hexenal, trans-2,4-hexadienal and their glutathione-conjugates carbonyls (GS-carbonyls) (PubMed:21329684)..
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55401
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat