Antibodies
Anti-AKR1C3 Antibody-Oligo Conjugate
SKU: aoc1123
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AKR1C3 Antibody-IF1
Antibody Target
- Target
- Aldo-keto reductase family 1 member C3
- UniProt Number
- P42330
- Target Description
- Cytosolic aldo-keto reductase that catalyzes the NADH and NADPH-dependent reduction of ketosteroids to hydroxysteroids. Acts as a NAD(P)(H)-dependent 3-, 17- and 20-ketosteroid reductase on the steroid nucleus and side chain and regulates the metabolism of androgens, estrogens and progesterone (PubMed:10622721, PubMed:11165022, PubMed:7650035, PubMed:9415401, PubMed:9927279). Displays the ability to catalyze both oxidation and reduction in vitro, but most probably acts as a reductase in vivo since the oxidase activity measured in vitro is inhibited by physiological concentration of NADPH (PubMed:11165022, PubMed:14672942). Acts preferentially as a 17-ketosteroid reductase and has the highest catalytic efficiency of the AKR1C enzyme for the reduction of delta4-androstenedione to form testosterone (PubMed:20036328). Reduces prostaglandin (PG) D2 to 11beta-prostaglandin F2, progesterone to 20alpha-hydroxyprogesterone and estrone to 17beta-estradiol (PubMed:10622721, PubMed:10998348, PubMed:11165022, PubMed:15047184, PubMed:19010934, PubMed:20036328). Catalyzes the transformation of the potent androgen dihydrotestosterone (DHT) into the less active form, 5-alpha-androstan-3-alpha,17-beta-diol (3-alpha-diol) (PubMed:10557352, PubMed:10998348, PubMed:11165022, PubMed:14672942, PubMed:7650035, PubMed:9415401). Also displays retinaldehyde reductase activity toward 9-cis-retinal (PubMed:21851338)..
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0857
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse