Antibodies
Anti-AKR1C3 Antibody-Oligo Conjugate
SKU: aoc1123
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AKR1C3 Antibody-IF1
Antibody Target
- Target
- Aldo-keto reductase family 1 member C3
- UniProt Number
- P42330
- Target Description
- Cytosolic aldo-keto reductase that catalyzes the NADH and NADPH-dependent reduction of ketosteroids to hydroxysteroids. Acts as a NAD(P)(H)-dependent 3-, 17- and 20-ketosteroid reductase on the steroid nucleus and side chain and regulates the metabolism of androgens, estrogens and progesterone. Displays the ability to catalyze both oxidation and reduction in vitro, but most probably acts as a reductase in vivo since the oxidase activity measured in vitro is inhibited by physiological concentration of NADPH. Acts preferentially as a 17-ketosteroid reductase and has the highest catalytic efficiency of the AKR1C enzyme for the reduction of delta4-androstenedione to form testosterone. Reduces prostaglandin (PG) D2 to 11beta-prostaglandin F2, progesterone to 20alpha-hydroxyprogesterone and estrone to 17beta-estradiol. Catalyzes the transformation of the potent androgen dihydrotestosterone (DHT) into the less active form, 5-alpha-androstan-3-alpha,17-beta-diol (3-alpha-diol). Also displays retinaldehyde reductase activity toward 9-cis-retinal.
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0857
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse