Antibodies

Anti-AKT2 Antibody-Oligo Conjugate

SKU: aoc1126

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-AKT2 Antibody-IF1

Antibody Target

Target
RAC-beta serine/threonine-protein kinase
UniProt Number
P31751
Target Description
Serine/threonine kinase closely related to AKT1 and AKT3. All 3 enzymes, AKT1, AKT2 and AKT3, are collectively known as AKT kinase. AKT regulates many processes including metabolism, proliferation, cell survival, growth and angiogenesis, through the phosphorylation of a range of downstream substrates. Over 100 substrates have been reported so far, although for most of them, the precise AKT kinase catalyzing the reaction was not specified. AKT regulates glucose uptake by mediating insulin-induced translocation of the SLC2A4/GLUT4 glucose transporter to the cell surface. Phosphorylation of PTPN1 at 'Ser-50' negatively modulates its phosphatase activity preventing dephosphorylation of the insulin receptor and the attenuation of insulin signaling. Phosphorylation of TBC1D4 triggers the binding of this effector to inhibitory 14-3-3 proteins, which is required for insulin-stimulated glucose transport. AKT also regulates the storage of glucose in the form of glycogen by phosphorylating GSK3A at 'Ser-21' and GSK3B at 'Ser-9', resulting in inhibition of its kinase activity. Phosphorylation of GSK3 isoforms by AKT is also thought to be one mechanism by which cell proliferation is driven. AKT also regulates cell survival via the phosphorylation of MAP3K5 (apoptosis signal-related kinase). Phosphorylation of 'Ser-83' decreases MAP3K5 kinase activity stimulated by oxidative stress and thereby prevents apoptosis. AKT mediates insulin-stimulated protein synthesis by phosphorylating TSC2 at 'Ser-939' and 'Thr-1462', thereby activating mTORC1 signaling and leading to both phosphorylation of 4E-BP1 and in activation of RPS6KB1. AKT is involved in the phosphorylation of members of the FOXO factors (Forkhead family of transcription factors), leading to binding of 14-3-3 proteins and cytoplasmic localization. In particular, FOXO1 is phosphorylated at 'Thr-24', 'Ser-256' and 'Ser-319'. FOXO3 and FOXO4 are phosphorylated on equivalent sites. AKT has an important role in the regulation of NF-kappa-B-dependent gene transcription and positively regulates the activity of CREB1 (cyclic AMP (cAMP)-response element binding protein). The phosphorylation of CREB1 induces the binding of accessory proteins that are necessary for the transcription of pro-survival genes such as BCL2 and MCL1. AKT phosphorylates 'Ser-454' on ATP citrate lyase (ACLY), thereby potentially regulating ACLY activity and fatty acid synthesis. Activates the 3B isoform of cyclic nucleotide phosphodiesterase (PDE3B) via phosphorylation of 'Ser-273', resulting in reduced cyclic AMP levels and inhibition of lipolysis. Phosphorylates PIKFYVE on 'Ser-318', which results in increased PI(3)P-5 activity. The Rho GTPase-activating protein DLC1 is another substrate and its phosphorylation is implicated in the regulation cell proliferation and cell growth. AKT plays a role as key modulator of the AKT-mTOR signaling pathway controlling the tempo of the process of newborn neurons integration during adult neurogenesis, including correct neuron positioning, dendritic development and synapse formation. Signals downstream of phosphatidylinositol 3-kinase (PI(3)K) to mediate the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor 1 (IGF1). AKT mediates the antiapoptotic effects of IGF1. Essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. May be involved in the regulation of the placental development (PubMed:21432781, PubMed:21620960). In response to lysophosphatidic acid stimulation, inhibits the ciliogenesis cascade. In this context, phosphorylates WDR44, hence stabilizing its interaction with Rab11 and preventing the formation of the ciliogenic Rab11-FIP3-RAB3IP complex. Also phosphorylates RAB3IP/Rabin8, thus may affect RAB3IP guanine nucleotide exchange factor (GEF) activity toward Rab8, which is important for cilia growth (PubMed:31204173). Phosphorylates PKP1, facilitating its interaction with YWHAG and translocation to the nucleus, ultimately resulting in a reduction in keratinocyte intercellular adhesion (By similarity). Phosphorylation of PKP1 increases PKP1 protein stability, translocation to the cytoplasm away from desmosome plaques and PKP1-driven cap-dependent translation (PubMed:23444369)..; FUNCTION: Several AKT2-specific substrates have been identified, including ANKRD2, C2CD5, CLK2 and PITX2. May play a role in myoblast differentiation. In this context, may act through PITX2 phosphorylation. Unphosphorylated PITX2 associates with an ELAVL1/HuR-containing complex, which stabilizes CCND1 cyclin mRNA, ensuring cell proliferation. Phosphorylation by AKT2 impairs this association, leading to CCND1 mRNA destabilization and progression towards differentiation (By similarity). Also involved in the negative regulation of myogenesis in response to stress conditions. In this context, acts by phosphorylating ANKRD2 (By similarity). May also be a key regulator of glucose uptake. Regulates insulin-stimulated glucose transport by the increase of glucose transporter GLUT4 translocation from intracellular stores to the plasma membrane. In this context, acts by phosphorylating C2CD5/CDP138 on 'Ser-197' in insulin-stimulated adipocytes (By similarity). Through the phosphorylation of CLK2 on 'Thr-343', involved in insulin-regulated suppression of hepatic gluconeogenesis (By similarity)..
Molecular Weight
56kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCELISA
Clone
ARC62648
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat