Antibodies
Anti-Albumin Antibody-Oligo Conjugate
SKU: aoc1129
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Albumin Antibody-IF1
Antibody Target
- Target
- Albumin
- UniProt Number
- P02768
- Target Description
- Binds water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs (Probable). Its main function is the regulation of the colloidal osmotic pressure of blood (Probable). Major zinc transporter in plasma, typically binds about 80% of all plasma zinc. Major calcium and magnesium transporter in plasma, binds approximately 45% of circulating calcium and magnesium in plasma. Potentially has more than two calcium-binding sites and might additionally bind calcium in a non-specific manner. The shared binding site between zinc and calcium at residue Asp-273 suggests a crosstalk between zinc and calcium transport in the blood. The rank order of affinity is zinc > calcium > magnesium. Binds to the bacterial siderophore enterobactin and inhibits enterobactin-mediated iron uptake of E.coli from ferric transferrin, and may thereby limit the utilization of iron and growth of enteric bacteria such as E.coli. Does not prevent iron uptake by the bacterial siderophore aerobactin.
- Molecular Weight
- 45kDa/47kDa/69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC63279
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat