Antibodies
Anti-Albumin Antibody-Oligo Conjugate
SKU: aoc1129
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Albumin Antibody-IF1
Antibody Target
- Target
- Albumin
- UniProt Number
- P02768
- Target Description
- Binds water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs (Probable). Its main function is the regulation of the colloidal osmotic pressure of blood (Probable). Major zinc transporter in plasma, typically binds about 80% of all plasma zinc (PubMed:19021548). Major calcium and magnesium transporter in plasma, binds approximately 45% of circulating calcium and magnesium in plasma (By similarity). Potentially has more than two calcium-binding sites and might additionally bind calcium in a non-specific manner (By similarity). The shared binding site between zinc and calcium at residue Asp-273 suggests a crosstalk between zinc and calcium transport in the blood (By similarity). The rank order of affinity is zinc > calcium > magnesium (By similarity). Binds to the bacterial siderophore enterobactin and inhibits enterobactin-mediated iron uptake of E.coli from ferric transferrin, and may thereby limit the utilization of iron and growth of enteric bacteria such as E.coli (PubMed:6234017). Does not prevent iron uptake by the bacterial siderophore aerobactin (PubMed:6234017)..
- Molecular Weight
- 45kDa/47kDa/69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC63279
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat