Antibodies
Anti-ALDH1A1 Antibody-Oligo Conjugate (ARC52440)
SKU: aoc1132
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ALDH1A1 Antibody (ARC52440)-IF1
Antibody Target
- Target
- Aldehyde dehydrogenase 1A1
- UniProt Number
- P00352
- Target Description
- Cytosolic dehydrogenase that catalyzes the irreversible oxidation of a wide range of aldehydes to their corresponding carboxylic acid (PubMed:12941160, PubMed:15623782, PubMed:17175089, PubMed:19296407, PubMed:25450233, PubMed:26373694). Functions downstream of retinol dehydrogenases and catalyzes the oxidation of retinaldehyde into retinoic acid, the second step in the oxidation of retinol/vitamin A into retinoic acid (By similarity). This pathway is crucial to control the levels of retinol and retinoic acid, two important molecules which excess can be teratogenic and cytotoxic (By similarity). Also oxidizes aldehydes resulting from lipid peroxidation like (E)-4-hydroxynon-2-enal/HNE, malonaldehyde and hexanal that form protein adducts and are highly cytotoxic. By participating for instance to the clearance of (E)-4-hydroxynon-2-enal/HNE in the lens epithelium prevents the formation of HNE-protein adducts and lens opacification (PubMed:12941160, PubMed:15623782, PubMed:19296407). Also functions downstream of fructosamine-3-kinase in the fructosamine degradation pathway by catalyzing the oxidation of 3-deoxyglucosone, the carbohydrate product of fructosamine 3-phosphate decomposition, which is itself a potent glycating agent that may react with lysine and arginine side-chains of proteins (PubMed:17175089). Also has an aminobutyraldehyde dehydrogenase activity and is probably part of an alternative pathway for the biosynthesis of GABA/4-aminobutanoate in midbrain, thereby playing a role in GABAergic synaptic transmission (By similarity)..
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC52440
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 250-350 of human ALDH1A1 (NP_000680.2).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat