Antibodies
Anti-ALDH1A2 Antibody-Oligo Conjugate
SKU: aoc1135
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ALDH1A2 Antibody-IF1
Antibody Target
- Target
- Retinal dehydrogenase 2
- UniProt Number
- O94788
- Target Description
- Catalyzes the NAD-dependent oxidation of aldehyde substrates, such as all-trans-retinal and all-trans-13,14-dihydroretinal, to their corresponding carboxylic acids, all-trans-retinoate and all-trans-13,14-dihydroretinoate, respectively. Retinoate signaling is critical for the transcriptional control of many genes, for instance it is crucial for initiation of meiosis in both male and female (Probable). Recognizes retinal as substrate, both in its free form and when bound to cellular retinol-binding protein. Can metabolize octanal and decanal, but has only very low activity with benzaldehyde, acetaldehyde and propanal. Displays complete lack of activity with citral.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1797
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat