AntibodiesNeuroMab
Anti-ALDH1L1 Antibody-Oligo Conjugate
SKU: aoc29
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ALDH1L1 Antibody-IF1
Antibody Target
- Target
- ALDH1L1
- UniProt Number
- O75891
- Target Description
- Cytosolic 10-formyltetrahydrofolate dehydrogenase that catalyzes the NADP(+)-dependent conversion of 10-formyltetrahydrofolate to tetrahydrofolate and carbon dioxide. May also have an NADP(+)-dependent aldehyde dehydrogenase activity towards formaldehyde, acetaldehyde, propionaldehyde, and benzaldehyde.
- Molecular Weight
- 100 kDa
- Synonyms
- Cytosolic 10-formyltetrahydrofolate dehydrogenase (10-FTHFDH) (FDH) (EC 1.5.1.6) (Aldehyde dehydrogenase family 1 member L1) (FBP-CI)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity against Aldh1L2
- Clone
- N103/39
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Protein amino acids 1-902 (full-length) of rat Aldh1L1 (accession number P28037) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMonkey (Non-Human Primate)MouseRat