AntibodiesNeuroMab
Anti-Aldh1L1 (Blotting) Antibody-Oligo Conjugate
SKU: aoc29
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aldh1L1 (Blotting) Antibody-IF1
Antibody Target
- Target
- Aldh1L1 (blotting)
- UniProt Number
- O75891
- Target Description
- Aldehyde dehydrogenase family 1 member L1 (Aldh1L1) is a member of the aldehyde dehydrogenase family. This protein is an enzyme that catalyzes the conversion of 10-formyltetrahydrofolate, NADP, and water to tetrahydrofolate, NADPH, and carbon dioxide. It is an astrocyte marker and also is expressed in the liver. It is proposed to play a role in regulation of cellular THF levels and inhibiting cell proliferation. Alterations in Aldh1L1 have been implicated in Congenital Hydrocephalus
- Molecular Weight
- 100 kDa
- Synonyms
- Cytosolic 10-formyltetrahydrofolate dehydrogenase (10-FTHFDH) (FDH) (EC 1.5.1.6) (Aldehyde dehydrogenase family 1 member L1) (FBP-CI)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity against Aldh1L2
- Clone
- N103/39
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Protein amino acids 1-902 (full-length) of rat Aldh1L1 (accession number P28037) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMonkey (Non-Human Primate)MouseRat