Antibodies
Anti-Alix | ALIX Antibody-Oligo Conjugate
SKU: aoc1143
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Alix | ALIX Antibody-IF1
Antibody Target
- Target
- Programmed cell death 6-interacting protein
- UniProt Number
- Q8WUM4
- Target Description
- Multifunctional protein involved in endocytosis, multivesicular body biogenesis, membrane repair, cytokinesis, apoptosis and maintenance of tight junction integrity. Class E VPS protein involved in concentration and sorting of cargo proteins of the multivesicular body (MVB) for incorporation into intralumenal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome. Binds to the phospholipid lysobisphosphatidic acid (LBPA) which is abundant in MVBs internal membranes. The MVB pathway requires the sequential function of ESCRT-O, -I,-II and -III complexes (PubMed:14739459). The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis (PubMed:17556548, PubMed:17853893). Adapter for a subset of ESCRT-III proteins, such as CHMP4, to function at distinct membranes. Required for completion of cytokinesis (PubMed:17556548, PubMed:17853893, PubMed:18641129). May play a role in the regulation of both apoptosis and cell proliferation. Regulates exosome biogenesis in concert with SDC1/4 and SDCBP (PubMed:22660413). By interacting with F-actin, PARD3 and TJP1 secures the proper assembly and positioning of actomyosin-tight junction complex at the apical sides of adjacent epithelial cells that defines a spatial membrane domain essential for the maintenance of epithelial cell polarity and barrier (By similarity)..; FUNCTION: (Microbial infection) Involved in HIV-1 virus budding. Can replace TSG101 it its role of supporting HIV-1 release; this function requires the interaction with CHMP4B. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as enveloped virus budding (HIV-1 and other lentiviruses)..
- Molecular Weight
- 96kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC3263
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat