Antibodies
Anti-ALK 4 Antibody-Oligo Conjugate
SKU: aoc1147
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ALK 4 Antibody-IF1
Antibody Target
- Target
- Activin receptor type-1B
- UniProt Number
- P36896
- Target Description
- Transmembrane serine/threonine kinase activin type-1 receptor forming an activin receptor complex with activin receptor type-2 (ACVR2A or ACVR2B). Transduces the activin signal from the cell surface to the cytoplasm and is thus regulating a many physiological and pathological processes including neuronal differentiation and neuronal survival, hair follicle development and cycling, FSH production by the pituitary gland, wound healing, extracellular matrix production, immunosuppression and carcinogenesis. Activin is also thought to have a paracrine or autocrine role in follicular development in the ovary. Within the receptor complex, type-2 receptors (ACVR2A and/or ACVR2B) act as a primary activin receptors whereas the type-1 receptors like ACVR1B act as downstream transducers of activin signals. Activin binds to type-2 receptor at the plasma membrane and activates its serine-threonine kinase. The activated receptor type-2 then phosphorylates and activates the type-1 receptor such as ACVR1B. Once activated, the type-1 receptor binds and phosphorylates the SMAD proteins SMAD2 and SMAD3, on serine residues of the C-terminal tail. Soon after their association with the activin receptor and subsequent phosphorylation, SMAD2 and SMAD3 are released into the cytoplasm where they interact with the common partner SMAD4. This SMAD complex translocates into the nucleus where it mediates activin-induced transcription. Inhibitory SMAD7, which is recruited to ACVR1B through FKBP1A, can prevent the association of SMAD2 and SMAD3 with the activin receptor complex, thereby blocking the activin signal. Activin signal transduction is also antagonized by the binding to the receptor of inhibin-B via the IGSF1 inhibin coreceptor. ACVR1B also phosphorylates TDP2.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1899
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat