Antibodies
Anti-ALK Antibody-Oligo Conjugate (ARC77750)
SKU: aoc1145
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ALK Antibody (ARC77750)-IF1
Antibody Target
- Target
- ALK tyrosine kinase receptor
- UniProt Number
- Q9UM73
- Target Description
- Neuronal receptor tyrosine kinase that is essentially and transiently expressed in specific regions of the central and peripheral nervous systems and plays an important role in the genesis and differentiation of the nervous system. Also acts as a key thinness protein involved in the resistance to weight gain: in hypothalamic neurons, controls energy expenditure acting as a negative regulator of white adipose tissue lipolysis and sympathetic tone to fine-tune energy homeostasis. Following activation by ALKAL2 ligand at the cell surface, transduces an extracellular signal into an intracellular response. In contrast, ALKAL1 is not a potent physiological ligand for ALK. Ligand-binding to the extracellular domain induces tyrosine kinase activation, leading to activation of the mitogen-activated protein kinase (MAPK) pathway. Phosphorylates almost exclusively at the first tyrosine of the Y-x-x-x-Y-Y motif. Induces tyrosine phosphorylation of CBL, FRS2, IRS1 and SHC1, as well as of the MAP kinases MAPK1/ERK2 and MAPK3/ERK1. ALK activation may also be regulated by pleiotrophin (PTN) and midkine (MDK). PTN-binding induces MAPK pathway activation, which is important for the anti-apoptotic signaling of PTN and regulation of cell proliferation. MDK-binding induces phosphorylation of the ALK target insulin receptor substrate (IRS1), activates mitogen-activated protein kinases (MAPKs) and PI3-kinase, resulting also in cell proliferation induction. Drives NF-kappa-B activation, probably through IRS1 and the activation of the AKT serine/threonine kinase. Recruitment of IRS1 to activated ALK and the activation of NF-kappa-B are essential for the autocrine growth and survival signaling of MDK.
- Molecular Weight
- 176 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC77750
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human