Antibodies
Anti-ALKBH1 Antibody-Oligo Conjugate (ARC2511)
SKU: aoc1149
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ALKBH1 Antibody (ARC2511)-IF1
Antibody Target
- Target
- Nucleic acid dioxygenase ALKBH1
- UniProt Number
- Q13686
- Target Description
- Dioxygenase that acts on nucleic acids, such as DNA and tRNA (PubMed:18603530, PubMed:27497299, PubMed:27745969). Requires molecular oxygen, alpha-ketoglutarate and iron (PubMed:18603530, PubMed:27497299). A number of activities have been described for this dioxygenase, but recent results suggest that it mainly acts on tRNAs and mediates their demethylation or oxidation depending on the context and subcellular compartment (PubMed:27497299, PubMed:27745969). Mainly acts as a tRNA demethylase by removing N(1)-methyladenine from various tRNAs, with a preference for N(1)-methyladenine at position 58 (m1A58) present on a stem loop structure of tRNAs (PubMed:27745969). Acts as a regulator of translation initiation and elongation in response to glucose deprivation: regulates both translation initiation, by mediating demethylation of tRNA(Met), and translation elongation, N(1)-methyladenine-containing tRNAs being preferentially recruited to polysomes to promote translation elongation (PubMed:27745969). In mitochondrion, specifically interacts with mt-tRNA(Met) and mediates oxidation of mt-tRNA(Met) methylated at cytosine(34) to form 5-formylcytosine (f(5)c) at this position (PubMed:27497299). mt-tRNA(Met) containing the f(5)c modification at the wobble position enables recognition of the AUA codon in addition to the AUG codon, expanding codon recognition in mitochondrial translation (PubMed:27497299). Specifically demethylates DNA methylated on the 6th position of adenine (N(6)-methyladenosine) DNA (PubMed:30017583, PubMed:30392959). N(6)-methyladenosine (m6A) DNA is present at some L1 elements in embryonic stem cells and probably promotes their silencing (By similarity). Demethylates mRNAs containing N(3)-methylcytidine modification (PubMed:31188562). Also able to repair alkylated single-stranded DNA by oxidative demethylation, but with low activity (PubMed:18603530). Also has DNA lyase activity and introduces double-stranded breaks at abasic sites: cleaves both single-stranded DNA and double-stranded DNA at abasic sites, with the greatest activity towards double-stranded DNA with two abasic sites (PubMed:19959401). DNA lyase activity does not require alpha-ketoglutarate and iron and leads to the formation of an irreversible covalent protein-DNA adduct with the 5' DNA product (PubMed:19959401, PubMed:23577621). DNA lyase activity is not required during base excision repair and class switch recombination of the immunoglobulin heavy chain during B lymphocyte activation. May play a role in placental trophoblast lineage differentiation (By similarity)..
- Molecular Weight
- 44 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC2511
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat