Antibodies
Anti-alpha 1 Antitrypsin Antibody-Oligo Conjugate (ARC54184)
SKU: aoc1154
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-alpha 1 Antitrypsin Antibody (ARC54184)-IF1
Antibody Target
- Target
- Alpha-1-antitrypsin
- UniProt Number
- P01009
- Target Description
- Inhibitor of serine proteases. Its primary target is elastase, but it also has a moderate affinity for plasmin and thrombin. Irreversibly inhibits trypsin, chymotrypsin and plasminogen activator. The aberrant form inhibits insulin-induced NO synthesis in platelets, decreases coagulation time and has proteolytic activity against insulin and plasmin.; FUNCTION: [Short peptide from AAT]: Reversible chymotrypsin inhibitor. It also inhibits elastase, but not trypsin. Its major physiological function is the protection of the lower respiratory tract against proteolytic destruction by human leukocyte elastase (HLE).
- Molecular Weight
- 47 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC54184
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human