Antibodies
Anti-alpha Synuclein Antibody-Oligo Conjugate (AMC50042)
SKU: aoc1168
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-alpha Synuclein Antibody (AMC50042)-IF1
Antibody Target
- Target
- Alpha-synuclein
- UniProt Number
- P37840
- Target Description
- Neuronal protein that plays several roles in synaptic activity such as regulation of synaptic vesicle trafficking and subsequent neurotransmitter release (PubMed:20798282, PubMed:26442590, PubMed:28288128, PubMed:30404828). Participates as a monomer in synaptic vesicle exocytosis by enhancing vesicle priming, fusion and dilation of exocytotic fusion pores (PubMed:28288128, PubMed:30404828). Mechanistically, acts by increasing local Ca(2+) release from microdomains which is essential for the enhancement of ATP-induced exocytosis (PubMed:30404828). Also acts as a molecular chaperone in its multimeric membrane-bound state, assisting in the folding of synaptic fusion components called SNAREs (Soluble NSF Attachment Protein REceptors) at presynaptic plasma membrane in conjunction with cysteine string protein-alpha/DNAJC5 (PubMed:20798282). This chaperone activity is important to sustain normal SNARE-complex assembly during aging (PubMed:20798282). Also plays a role in the regulation of the dopamine neurotransmission by associating with the dopamine transporter (DAT1) and thereby modulating its activity (PubMed:26442590)..
- Molecular Weight
- 14kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- AMC50042
- Isotype
- IgG1. Rabbit-derived mouse chimeric antibody
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat