Antibodies
Anti-Aly Antibody-Oligo Conjugate
SKU: aoc1177
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aly Antibody-IF1
Antibody Target
- Target
- THO complex subunit 4
- UniProt Number
- Q86V81
- Target Description
- Functions as an mRNA export adapter; component of the transcription/export (TREX) complex which is thought to couple mRNA transcription, processing and nuclear export, and specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NXF1 pathway. Involved in the nuclear export of intronless mRNA; proposed to be recruited to intronless mRNA by ATP-bound DDX39B. Plays a key role in mRNP recognition and mRNA packaging by bridging the mRNP-bound EJC and the TREX core complex. TREX recruitment occurs via an interaction between ALYREF/THOC4 and the cap-binding protein NCBP1. Required for TREX complex assembly and for linking DDX39B to the cap-binding complex (CBC). Binds mRNA which is thought to be transferred to the NXF1-NXT1 heterodimer for export (TAP/NXF1 pathway). In conjunction with THOC5 functions in NXF1-NXT1 mediated nuclear export of HSP70 mRNA; both proteins enhance the RNA binding activity of NXF1 and are required for NXF1 localization to the nuclear rim. Involved in mRNA export of C5-methylcytosine (m5C)-containing mRNAs: specifically recognizes and binds m5C mRNAs and mediates their nucleo-cytoplasmic shuttling. Acts as a chaperone and promotes the dimerization of transcription factors containing basic leucine zipper (bZIP) domains and thereby promotes transcriptional activation. Involved in transcription elongation and genome stability.; FUNCTION: (Microbial infection) The TREX complex is essential for the export of Kaposi's sarcoma-associated herpesvirus (KSHV) intronless mRNAs and infectious virus production; ALYREF/THOC4 mediates the recruitment of the TREX complex to the intronless viral mRNA.
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0959
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat