Antibodies
Anti-AMPK alpha 1/2 Antibody-Oligo Conjugate
SKU: aoc1182
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AMPK alpha 1/2 Antibody-IF1
Antibody Target
- Target
- 5'-AMP-activated protein kinase catalytic subunit alpha-1
- UniProt Number
- Q13131
- Additional Target Information
- This antibody also binds 5'-AMP-activated protein kinase catalytic subunit alpha-2, Uniprot:P54646.
- Target Description
- Catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Regulates lipid synthesis by phosphorylating and inactivating lipid metabolic enzymes such as ACACA, ACACB, GYS1, HMGCR and LIPE; regulates fatty acid and cholesterol synthesis by phosphorylating acetyl-CoA carboxylase (ACACA and ACACB) and hormone-sensitive lipase (LIPE) enzymes, respectively. Promotes lipolysis of lipid droplets by mediating phosphorylation of isoform 1 of CHKA (CHKalpha2). Regulates insulin-signaling and glycolysis by phosphorylating IRS1, PFKFB2 and PFKFB3. AMPK stimulates glucose uptake in muscle by increasing the translocation of the glucose transporter SLC2A4/GLUT4 to the plasma membrane, possibly by mediating phosphorylation of TBC1D4/AS160. Regulates transcription and chromatin structure by phosphorylating transcription regulators involved in energy metabolism such as CRTC2/TORC2, FOXO3, histone H2B, HDAC5, MEF2C, MLXIPL/ChREBP, EP300, HNF4A, p53/TP53, SREBF1, SREBF2 and PPARGC1A. Acts as a key regulator of glucose homeostasis in liver by phosphorylating CRTC2/TORC2, leading to CRTC2/TORC2 sequestration in the cytoplasm. In response to stress, phosphorylates 'Ser-36' of histone H2B (H2BS36ph), leading to promote transcription. Acts as a key regulator of cell growth and proliferation by phosphorylating FNIP1, TSC2, RPTOR, WDR24 and ATG1/ULK1: in response to nutrient limitation, negatively regulates the mTORC1 complex by phosphorylating RPTOR component of the mTORC1 complex and by phosphorylating and activating TSC2. Also phosphorylates and inhibits GATOR2 subunit WDR24 in response to nutrient limitation, leading to suppress glucose-mediated mTORC1 activation. In response to energetic stress, phosphorylates FNIP1, inactivating the non-canonical mTORC1 signaling, thereby promoting nuclear translocation of TFEB and TFE3, and inducing transcription of lysosomal or autophagy genes. In response to nutrient limitation, promotes autophagy by phosphorylating and activating ATG1/ULK1. In that process, it also activates WDR45/WIPI4. Phosphorylates CASP6, thereby preventing its autoprocessing and subsequent activation. In response to nutrient limitation, phosphorylates transcription factor FOXO3 promoting FOXO3 mitochondrial import. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. AMPK also acts as a regulator of circadian rhythm by mediating phosphorylation of CRY1, leading to destabilize it. May regulate the Wnt signaling pathway by phosphorylating CTNNB1, leading to stabilize it. Also has tau-protein kinase activity: in response to amyloid beta A4 protein (APP) exposure, activated by CAMKK2, leading to phosphorylation of MAPT/TAU; however the relevance of such data remains unclear in vivo. Also phosphorylates CFTR, EEF2K, KLC1, NOS3 and SLC12A1. Regulates hepatic lipogenesis. Activated via SIRT3, represses sterol regulatory element-binding protein (SREBP) transcriptional activities and ATP-consuming lipogenesis to restore cellular energy balance. Upon stress, regulates mitochondrial fragmentation through phosphorylation of MTFR1L.
- Molecular Weight
- 64kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC72811
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat