Antibodies
Anti-AMPK beta 1 Antibody-Oligo Conjugate
SKU: aoc1183
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AMPK beta 1 Antibody-IF1
Antibody Target
- Target
- 5'-AMP-activated protein kinase subunit beta-1
- UniProt Number
- Q9Y478
- Target Description
- Non-catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. Beta non-catalytic subunit acts as a scaffold on which the AMPK complex assembles, via its C-terminus that bridges alpha (PRKAA1 or PRKAA2) and gamma subunits (PRKAG1, PRKAG2 or PRKAG3).
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1061
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat