Antibodies
Anti-Angiopoietin 1 Antibody-Oligo Conjugate
SKU: aoc1185
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Angiopoietin 1 Antibody-IF1
Antibody Target
- Target
- Angiopoietin-1
- UniProt Number
- Q15389
- Target Description
- Binds and activates TEK/TIE2 receptor by inducing its dimerization and tyrosine phosphorylation. Plays an important role in the regulation of angiogenesis, endothelial cell survival, proliferation, migration, adhesion and cell spreading, reorganization of the actin cytoskeleton, but also maintenance of vascular quiescence. Required for normal angiogenesis and heart development during embryogenesis. After birth, activates or inhibits angiogenesis, depending on the context. Inhibits angiogenesis and promotes vascular stability in quiescent vessels, where endothelial cells have tight contacts. In quiescent vessels, ANGPT1 oligomers recruit TEK to cell-cell contacts, forming complexes with TEK molecules from adjoining cells, and this leads to preferential activation of phosphatidylinositol 3-kinase and the AKT1 signaling cascades. In migrating endothelial cells that lack cell-cell adhesions, ANGT1 recruits TEK to contacts with the extracellular matrix, leading to the formation of focal adhesion complexes, activation of PTK2/FAK and of the downstream kinases MAPK1/ERK2 and MAPK3/ERK1, and ultimately to the stimulation of sprouting angiogenesis. Mediates blood vessel maturation/stability. Implicated in endothelial developmental processes later and distinct from that of VEGF. Appears to play a crucial role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme..
- Molecular Weight
- 58k Da
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0248
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat