Antibodies
Anti-Annexin A1 Antibody-Oligo Conjugate
SKU: aoc1190
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Annexin A1 Antibody-IF1
Antibody Target
- Target
- Annexin A1
- UniProt Number
- P04083
- Target Description
- Plays important roles in the innate immune response as effector of glucocorticoid-mediated responses and regulator of the inflammatory process. Has anti-inflammatory activity. Plays a role in glucocorticoid-mediated down-regulation of the early phase of the inflammatory response. Contributes to the adaptive immune response by enhancing signaling cascades that are triggered by T-cell activation, regulates differentiation and proliferation of activated T-cells. Promotes the differentiation of T-cells into Th1 cells and negatively regulates differentiation into Th2 cells. Has no effect on unstimulated T cells. Negatively regulates hormone exocytosis via activation of the formyl peptide receptors and reorganization of the actin cytoskeleton. Has high affinity for Ca(2+) and can bind up to eight Ca(2+) ions. Displays Ca(2+)-dependent binding to phospholipid membranes. Plays a role in the formation of phagocytic cups and phagosomes. Plays a role in phagocytosis by mediating the Ca(2+)-dependent interaction between phagosomes and the actin cytoskeleton.; FUNCTION: [Annexin Ac2-26]: Functions at least in part by activating the formyl peptide receptors and downstream signaling cascades. Promotes chemotaxis of granulocytes and monocytes via activation of the formyl peptide receptors. Promotes rearrangement of the actin cytoskeleton, cell polarization and cell migration. Promotes resolution of inflammation and wound healing. Acts via neutrophil N-formyl peptide receptors to enhance the release of CXCL2.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC66904
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat