Antibodies
Anti-Annexin A1 Antibody-Oligo Conjugate
SKU: aoc1190
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Annexin A1 Antibody-IF1
Antibody Target
- Target
- Annexin A1
- UniProt Number
- P04083
- Target Description
- Plays important roles in the innate immune response as effector of glucocorticoid-mediated responses and regulator of the inflammatory process. Has anti-inflammatory activity (PubMed:8425544). Plays a role in glucocorticoid-mediated down-regulation of the early phase of the inflammatory response (By similarity). Contributes to the adaptive immune response by enhancing signaling cascades that are triggered by T-cell activation, regulates differentiation and proliferation of activated T-cells (PubMed:17008549). Promotes the differentiation of T-cells into Th1 cells and negatively regulates differentiation into Th2 cells (PubMed:17008549). Has no effect on unstimulated T cells (PubMed:17008549). Negatively regulates hormone exocytosis via activation of the formyl peptide receptors and reorganization of the actin cytoskeleton (PubMed:19625660). Has high affinity for Ca(2+) and can bind up to eight Ca(2+) ions (By similarity). Displays Ca(2+)-dependent binding to phospholipid membranes (PubMed:2532504, PubMed:8557678). Plays a role in the formation of phagocytic cups and phagosomes. Plays a role in phagocytosis by mediating the Ca(2+)-dependent interaction between phagosomes and the actin cytoskeleton (By similarity)..; FUNCTION: [Annexin Ac2-26]: Functions at least in part by activating the formyl peptide receptors and downstream signaling cascades (PubMed:15187149, PubMed:22879591, PubMed:25664854). Promotes chemotaxis of granulocytes and monocytes via activation of the formyl peptide receptors (PubMed:15187149). Promotes rearrangement of the actin cytoskeleton, cell polarization and cell migration (PubMed:15187149). Promotes resolution of inflammation and wound healing (PubMed:25664854). Acts via neutrophil N-formyl peptide receptors to enhance the release of CXCL2 (PubMed:22879591)..
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC66904
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat