Antibodies
Anti-Annexin A2 Antibody-Oligo Conjugate
SKU: aoc1192
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Annexin A2 Antibody-IF1
Antibody Target
- Target
- Annexin A2
- UniProt Number
- P07355
- Target Description
- Calcium-regulated membrane-binding protein whose affinity for calcium is greatly enhanced by anionic phospholipids. It binds two calcium ions with high affinity. May be involved in heat-stress response. Inhibits PCSK9-enhanced LDLR degradation, probably reduces PCSK9 protein levels via a translational mechanism but also competes with LDLR for binding with PCSK9. Binds to endosomes damaged by phagocytosis of particulate wear debris and participates in endosomal membrane stabilization, thereby limiting NLRP3 inflammasome activation. Required for endothelial cell surface plasmin generation and may support fibrinolytic surveillance and neoangiogenesis.; FUNCTION: (Microbial infection) Binds M.pneumoniae CARDS toxin, probably serves as one receptor for this pathogen. When ANXA2 is down-regulated by siRNA, less toxin binds to human cells and less vacuolization (a symptom of M.pneumoniae infection) is seen.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0554
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat