Antibodies
Anti-ANP32B Antibody-Oligo Conjugate
SKU: aoc1197
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ANP32B Antibody-IF1
Antibody Target
- Target
- Acidic leucine-rich nuclear phosphoprotein 32 family member B
- UniProt Number
- Q92688
- Target Description
- Multifunctional protein that is involved in the regulation of many processes including cell proliferation, apoptosis, cell cycle progression or transcription. Regulates the proliferation of neuronal stem cells, differentiation of leukemic cells and progression from G1 to S phase of the cell cycle. As negative regulator of caspase-3-dependent apoptosis, may act as an antagonist of ANP32A in regulating tissue homeostasis. Exhibits histone chaperone properties, able to recruit histones to certain promoters, thus regulating the transcription of specific genes. Also plays an essential role in the nucleocytoplasmic transport of specific mRNAs via the uncommon nuclear mRNA export receptor XPO1/CRM1. Participates in the regulation of adequate adaptive immune responses by acting on mRNA expression and cell proliferation.; FUNCTION: (Microbial infection) Plays an essential role in influenza A and B viral genome replication. Also plays a role in foamy virus mRNA export from the nucleus to the cytoplasm.
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC2014
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat