Antibodies
Anti-ANP32B Antibody-Oligo Conjugate
SKU: aoc1197
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ANP32B Antibody-IF1
Antibody Target
- Target
- Acidic leucine-rich nuclear phosphoprotein 32 family member B
- UniProt Number
- Q92688
- Target Description
- Multifunctional protein that is involved in the regulation of many processes including cell proliferation, apoptosis, cell cycle progression or transcription (PubMed:18039846, PubMed:20015864). Regulates the proliferation of neuronal stem cells, differentiation of leukemic cells and progression from G1 to S phase of the cell cycle. As negative regulator of caspase-3-dependent apoptosis, may act as an antagonist of ANP32A in regulating tissue homeostasis (PubMed:20015864). Exhibits histone chaperone properties, able to recruit histones to certain promoters, thus regulating the transcription of specific genes (PubMed:18039846, PubMed:20538007). Also plays an essential role in the nucleocytoplasmic transport of specific mRNAs via the uncommon nuclear mRNA export receptor XPO1/CRM1 (PubMed:17178712). Participates in the regulation of adequate adaptive immune responses by acting on mRNA expression and cell proliferation (By similarity)..; FUNCTION: (Microbial infection) Plays an essential role in influenza A and B viral genome replication (PubMed:31217244, PubMed:33045004). Also plays a role in foamy virus mRNA export from the nucleus to the cytoplasm (PubMed:21159877)..
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC2014
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat