Antibodies
Anti-AP2A1 Antibody-Oligo Conjugate
SKU: aoc1203
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AP2A1 Antibody-IF1
Antibody Target
- Target
- AP-2 complex subunit alpha-1
- UniProt Number
- O95782
- Target Description
- Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin-coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. During long-term potentiation in hippocampal neurons, AP-2 is responsible for the endocytosis of ADAM10. The AP-2 alpha subunit binds polyphosphoinositide-containing lipids, positioning AP-2 on the membrane. The AP-2 alpha subunit acts via its C-terminal appendage domain as a scaffolding platform for endocytic accessory proteins. The AP-2 alpha and AP-2 sigma subunits are thought to contribute to the recognition of the [ED]-X-X-X-L-[LI] motif.
- Molecular Weight
- 108kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0998
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat