Antibodies
Anti-APC Antibody-Oligo Conjugate (ARC0346)
SKU: aoc1208
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-APC Antibody (ARC0346)-PLA1
Antibody Target
- Target
- Adenomatous polyposis coli protein
- UniProt Number
- P25054
- Target Description
- Tumor suppressor. Promotes rapid degradation of CTNNB1 and participates in Wnt signaling as a negative regulator. APC activity is correlated with its phosphorylation state. Activates the GEF activity of SPATA13 and ARHGEF4. Plays a role in hepatocyte growth factor (HGF)-induced cell migration. Required for MMP9 up-regulation via the JNK signaling pathway in colorectal tumor cells. Associates with both microtubules and actin filaments, components of the cytoskeleton. Plays a role in mediating the organization of F-actin into ordered bundles. Functions downstream of Rho GTPases and DIAPH1 to selectively stabilize microtubules. Acts as a mediator of ERBB2-dependent stabilization of microtubules at the cell cortex. It is required for the localization of MACF1 to the cell membrane and this localization of MACF1 is critical for its function in microtubule stabilization.
- Molecular Weight
- 312kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0346
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat