Antibodies
Anti-APC6 Antibody-Oligo Conjugate
SKU: aoc1210
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-APC6 Antibody-IF1
Antibody Target
- Target
- Cell division cycle protein 16 homolog
- UniProt Number
- Q13042
- Target Description
- Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. The APC/C complex catalyzes assembly of branched 'Lys-11'-/'Lys-48'-linked branched ubiquitin chains on target proteins.
- Molecular Weight
- 72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC2053
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat