Antibodies
Anti-Apolipoprotein CI Antibody-Oligo Conjugate
SKU: aoc1220
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Apolipoprotein CI Antibody-IF1
Antibody Target
- Target
- Apolipoprotein C-I
- UniProt Number
- P02654
- Target Description
- Inhibitor of lipoprotein binding to the low density lipoprotein (LDL) receptor, LDL receptor-related protein, and very low density lipoprotein (VLDL) receptor. Associates with high density lipoproteins (HDL) and the triacylglycerol-rich lipoproteins in the plasma and makes up about 10% of the protein of the VLDL and 2% of that of HDL. Appears to interfere directly with fatty acid uptake and is also the major plasma inhibitor of cholesteryl ester transfer protein (CETP). Binds free fatty acids and reduces their intracellular esterification. Modulates the interaction of APOE with beta-migrating VLDL and inhibits binding of beta-VLDL to the LDL receptor-related protein..
- Molecular Weight
- 9kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1641
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat