Antibodies
Anti-APP Antibody-Oligo Conjugate (ARC65337)
SKU: aoc1223
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-APP Antibody (ARC65337)-IF1
Antibody Target
- Target
- Amyloid-beta precursor protein
- UniProt Number
- P05067
- Target Description
- Functions as a cell surface receptor and performs physiological functions on the surface of neurons relevant to neurite growth, neuronal adhesion and axonogenesis. Interaction between APP molecules on neighboring cells promotes synaptogenesis (PubMed:25122912). Involved in cell mobility and transcription regulation through protein-protein interactions. Can promote transcription activation through binding to APBB1-KAT5 and inhibits Notch signaling through interaction with Numb. Couples to apoptosis-inducing pathways such as those mediated by G(o) and JIP. Inhibits G(o) alpha ATPase activity (By similarity). Acts as a kinesin I membrane receptor, mediating the axonal transport of beta-secretase and presenilin 1 (By similarity). By acting as a kinesin I membrane receptor, plays a role in axonal anterograde transport of cargo towards synapses in axons (PubMed:17062754, PubMed:23011729). Involved in copper homeostasis/oxidative stress through copper ion reduction. In vitro, copper-metallated APP induces neuronal death directly or is potentiated through Cu(2+)-mediated low-density lipoprotein oxidation. Can regulate neurite outgrowth through binding to components of the extracellular matrix such as heparin and collagen I and IV. The splice isoforms that contain the BPTI domain possess protease inhibitor activity. Induces a AGER-dependent pathway that involves activation of p38 MAPK, resulting in internalization of amyloid-beta peptide and leading to mitochondrial dysfunction in cultured cortical neurons. Provides Cu(2+) ions for GPC1 which are required for release of nitric oxide (NO) and subsequent degradation of the heparan sulfate chains on GPC1..; FUNCTION: Amyloid-beta peptides are lipophilic metal chelators with metal-reducing activity. Bind transient metals such as copper, zinc and iron. In vitro, can reduce Cu(2+) and Fe(3+) to Cu(+) and Fe(2+), respectively. Amyloid-beta peptides bind to lipoproteins and apolipoproteins E and J in the CSF and to HDL particles in plasma, inhibiting metal-catalyzed oxidation of lipoproteins. Promotes both tau aggregation and TPK II-mediated phosphorylation. Interaction with overexpressed HADH2 leads to oxidative stress and neurotoxicity. Also binds GPC1 in lipid rafts.; FUNCTION: [Amyloid-beta protein 42]: More effective reductant than amyloid-beta protein 40. May activate mononuclear phagocytes in the brain and elicit inflammatory responses.; FUNCTION: Appicans elicit adhesion of neural cells to the extracellular matrix and may regulate neurite outgrowth in the brain..; FUNCTION: The gamma-CTF peptides as well as the caspase-cleaved peptides, including C31, are potent enhancers of neuronal apoptosis.
- Molecular Weight
- 4kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCDBELISA
- Clone
- ARC65337
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Mouse