Antibodies

Anti-APP Antibody-Oligo Conjugate (ARC63663)

SKU: aoc1224

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-APP Antibody (ARC63663)-IF1

Antibody Target

Target
Amyloid-beta precursor protein
UniProt Number
P05067
Target Description
Functions as a cell surface receptor and performs physiological functions on the surface of neurons relevant to neurite growth, neuronal adhesion and axonogenesis. Interaction between APP molecules on neighboring cells promotes synaptogenesis. Involved in cell mobility and transcription regulation through protein-protein interactions. Can promote transcription activation through binding to APBB1-KAT5 and inhibits Notch signaling through interaction with Numb. Couples to apoptosis-inducing pathways such as those mediated by G(o) and JIP. Inhibits G(o) alpha ATPase activity. Acts as a kinesin I membrane receptor, mediating the axonal transport of beta-secretase and presenilin 1. By acting as a kinesin I membrane receptor, plays a role in axonal anterograde transport of cargo towards synapses in axons. Involved in copper homeostasis/oxidative stress through copper ion reduction. In vitro, copper-metallated APP induces neuronal death directly or is potentiated through Cu(2+)-mediated low-density lipoprotein oxidation. Can regulate neurite outgrowth through binding to components of the extracellular matrix such as heparin and collagen I and IV. The splice isoforms that contain the BPTI domain possess protease inhibitor activity. Induces a AGER-dependent pathway that involves activation of p38 MAPK, resulting in internalization of amyloid-beta peptide and leading to mitochondrial dysfunction in cultured cortical neurons. Provides Cu(2+) ions for GPC1 which are required for release of nitric oxide (NO) and subsequent degradation of the heparan sulfate chains on GPC1.; FUNCTION: Amyloid-beta peptides are lipophilic metal chelators with metal-reducing activity. Bind transient metals such as copper, zinc and iron. In vitro, can reduce Cu(2+) and Fe(3+) to Cu(+) and Fe(2+), respectively. Amyloid-beta peptides bind to lipoproteins and apolipoproteins E and J in the CSF and to HDL particles in plasma, inhibiting metal-catalyzed oxidation of lipoproteins. Promotes both tau aggregation and TPK II-mediated phosphorylation. Interaction with overexpressed HADH2 leads to oxidative stress and neurotoxicity. Also binds GPC1 in lipid rafts.; FUNCTION: [Amyloid-beta protein 42]: More effective reductant than amyloid-beta protein 40. May activate mononuclear phagocytes in the brain and elicit inflammatory responses.; FUNCTION: Appicans elicit adhesion of neural cells to the extracellular matrix and may regulate neurite outgrowth in the brain.; FUNCTION: The gamma-CTF peptides as well as the caspase-cleaved peptides, including C31, are potent enhancers of neuronal apoptosis.
Molecular Weight
4 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIF-PIHCDBELISA
Clone
ARC63663
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Mouse