Antibodies
Anti-Aquaporin 1 Antibody-Oligo Conjugate
SKU: aoc1227
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aquaporin 1 Antibody-IF1
Antibody Target
- Target
- Aquaporin-1
- UniProt Number
- P29972
- Target Description
- Forms a water channel that facilitates the transport of water across cell membranes, playing a crucial role in water homeostasis in various tissues (PubMed:1373524, PubMed:23219802). Could also be permeable to small solutes including hydrogen peroxide, glycerol and gases such as amonnia (NH3), nitric oxide (NO) and carbon dioxide (CO2) (PubMed:16682607, PubMed:17012249, PubMed:19273840, PubMed:33028705, PubMed:8584435). Recruited to the ankyrin-1 complex, a multiprotein complex of the erythrocyte membrane, it could be part of a CO2 metabolon, linking facilitated diffusion of CO2 across the membrane, anion exchange of Cl(-)/HCO3(-) and interconversion of dissolved CO2 and carbonic acid in the cytosol (PubMed:17012249, PubMed:35835865). In vitro, it shows non-selective gated cation channel activity and may be permeable to cations like K(+) and Na(+) in vivo (PubMed:36949749, PubMed:8703053)..
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0925
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat