Antibodies
Anti-Aquaporin 4 Antibody-Oligo Conjugate
SKU: aoc1228
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aquaporin 4 Antibody-IF1
Antibody Target
- Target
- Aquaporin-4
- UniProt Number
- P55087
- Target Description
- Forms a water-specific channel. Plays an important role in brain water homeostasis. It is involved in glymphatic solute transport and is required for a normal rate of water exchange across the blood brain interface. Required for normal levels of cerebrospinal fluid influx into the brain cortex and parenchyma along paravascular spaces that surround penetrating arteries, and for normal drainage of interstitial fluid along paravenous drainage pathways. Thereby, it is required for normal clearance of solutes from the brain interstitial fluid, including soluble beta-amyloid peptides derived from APP. Plays a redundant role in urinary water homeostasis and urinary concentrating ability.
- Molecular Weight
- 32 kDa/35 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- AMC50111
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat