Antibodies
Anti-Aquaporin 5 Antibody-Oligo Conjugate
SKU: aoc1229
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aquaporin 5 Antibody-IF1
Antibody Target
- Target
- Aquaporin-5
- UniProt Number
- P55064
- Target Description
- Aquaporins form homotetrameric transmembrane channels, with each monomer independently mediating water transport across the plasma membrane along its osmotic gradient (PubMed:18768791, PubMed:8621489). Plays an important role in fluid secretion in salivary glands (By similarity). Required for TRPV4 activation by hypotonicity. Together with TRPV4, controls regulatory volume decrease in salivary epithelial cells (PubMed:16571723). Seems to play a redundant role in water transport in the eye, lung and in sweat glands (By similarity)..
- Molecular Weight
- 28 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59536
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat