Antibodies
Anti-Aquaporin 5 Antibody-Oligo Conjugate
SKU: aoc1229
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aquaporin 5 Antibody-IF1
Antibody Target
- Target
- Aquaporin-5
- UniProt Number
- P55064
- Target Description
- Aquaporins form homotetrameric transmembrane channels, with each monomer independently mediating water transport across the plasma membrane along its osmotic gradient. Plays an important role in fluid secretion in salivary glands. Required for TRPV4 activation by hypotonicity. Together with TRPV4, controls regulatory volume decrease in salivary epithelial cells. Seems to play a redundant role in water transport in the eye, lung and in sweat glands.
- Molecular Weight
- 28 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59536
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat